Skip navigation
PYHS - Header

DNA for the Defense Bar, NIJ DNA Initiative, 2012

Download original document:
Brief thumbnail
This text is machine-read, and may contain errors. Check the original document to verify accuracy.
JUNE 2012

DNA for the Defense Bar

DNA

I N I T I A T I V E
�

www.NIJ.gov
�

U.S. Department of Justice
Office of Justice Programs
810 Seventh Street N.W.
Washington, DC 20531

Eric H. Holder, Jr.
Attorney General
Mary Lou Leary
Acting Assistant Attorney General
John H. Laub
Director, National Institute of Justice

Office of Justice Programs
Innovation • Partnerships • Safer Neighborhoods
www.ojp.usdoj.gov

DNA for the Defense Bar
JUNE 2012

National Institute of Justice

This document is not intended to create, and may not be relied upon to
create, any rights, substantive or procedural, enforceable at law by any
party in any matter civil or criminal.
The opinions, factual and other findings, conclusions, or recommendations in this publication represent the points of view of a majority of the
KADAP members and do not necessarily reflect the official position or
policies of the U.S. Department of Justice.

NCJ 237975

Foreword
�

The National Institute of Justice is pleased to release DNA for the Defense Bar. This is the fourth publication in a
series designed to increase the field’s understanding of the science of DNA and its application in the courtroom. The
other three publications offer free online training tools for teaching officers of the court about forensic DNA analysis,
assisting state and local prosecutors in preparing DNA-related cases, and teaching senior law enforcement officials
about policy and practices of effective DNA analysis:
■■ Principles of Forensic DNA for Officers of the Court: nij.gov/training/dna-officers-court.htm.
■■ DNA: A Prosecutor’s Practice Notebook: nij.gov/training/dna-prosecutors-notebook.htm.
■■ DNA for Law Enforcement Decision Makers: nij.gov/training/dna-decisionmakers.htm.

DNA for the Defense Bar is specifically designed for criminal defense attorneys. NIJ engaged an impressive multidisciplinary team to produce the most up-to-date information possible in the ever-evolving arena of forensic DNA.
Our sincere gratitude goes to our Technical Working Group members:
Jack Ballantyne
Associate Director of Research
University of Central Florida
Orlando, FL

Catherine Cothran
Palm Beach County Sheriff’s Office
Forensic Biology Unit
West Palm Beach, FL

Jules Epstein
Defense Attorney and Law Professor
Widener School of Law
Wilmington, DE

Christine Funk
Assistant State Public Defender
Minnesota Board of Public Defense Trial Team
Hastings, MN

Chris Plourd
Defense Attorney
San Diego, CA

Vanessa Potkin
Innocence Project
New York City, NY

Ron Reinstein
Arizona Superior Court Judge (retired)
Phoenix, AZ

Edward Ungvarsky
DC Public Defender Service
Washington, DC

I also want to acknowledge the work of the National Clearinghouse for Science, Technology and the Law (NCSTL)
at Stetson University College of Law in Tampa, FL — with special thanks to NCSTL’s Director of Outreach, Anjali
Swienton, who brought her unique background as both a forensic scientist and a lawyer to this comprehensive effort.
It is important to note that NIJ is releasing DNA for the Defense Bar in print — as well as electronically, nij.gov/
pubs-sum/237975 — because we have heard the voices from the field. We know that defense attorneys will want
to be able to access this information in places where the Internet may not be available.
Since 2004, NIJ has been responsible for administering public funds to ensure that the nation’s criminal justice
system maximizes the use of DNA in solving crimes, protecting the innocent, and improving public safety. I hope
you will find that DNA for the Defense Bar meets that goal.

John H. Laub, Ph.D.
Director
National Institute of Justice

DNA

INITIATIVE

iii

Contents
1

Introduction .................................................................................................................................... 1
�

2

DNA Basics: The Science of DNA.................................................................................................. 3
�
1. What Is DNA? ...........................................................................................................................3
�
2. Where Is DNA Evidence Found? ..............................................................................................8
�
3. What Are the Basic Steps in DNA Typing? .............................................................................12
�
4. What Are the Categories of DNA and DNA Tests?.................................................................12
�
5. Emerging Technologies ..........................................................................................................16
�
6. How to Find Resources and Stay Current...............................................................................16
�
7. Forensic DNA Lab Report Basics............................................................................................17
�
Endnotes.....................................................................................................................................19
�

3

Discovery: Getting to Know a Case With DNA Evidence .......................................................... 21
�
1. From Crime Scene to Laboratory............................................................................................21
�
2. Lab-Directed Discovery...........................................................................................................23
�
3. Brady and DNA Cases.............................................................................................................31
�
Endnotes.....................................................................................................................................31
�

4

DNA Evidence: Evaluation, Assessment and Response ............................................................ 33
�
1. Evidence .................................................................................................................................33
�
2. Funding for the Defense DNA Expert .....................................................................................35
�
3. Evidence Consumption ...........................................................................................................36
�
Endnotes.....................................................................................................................................37
�

5

DNA Basics: Laboratory Issues ................................................................................................... 39
�
1. Standards for Labs, Personnel and Procedures ......................................................................39
�
2. QAS Requirements for Laboratories.......................................................................................39
�
3. QAS Requirements for Laboratory Procedures ......................................................................40
�
4. QAS Requirements for Laboratory Personnel.........................................................................42
�

DNA

INITIATIVE

v

CoNtENts

6


DNA Basics: Understanding and Evaluating Test Results ...................................................... 43
�
1. With Your Expert’s Guidance, Interview the Lab Analyst .......................................................43
�
2. Interpretation and Reporting of Results..................................................................................44
�
3. Technical Artifacts and Interpretation of Results ....................................................................53
�
4. What the DNA Results Do Not Show .....................................................................................62
�
5. Alternate Theories of Defense................................................................................................63
�
6. DNA and the Client .................................................................................................................64
�
7. Types of Statistics — What Do They Mean? ..........................................................................65
�
Endnote.......................................................................................................................................70
�

7

DNA Basics: Pretrial Preparation ................................................................................................. 71
�
1. Should the Defense Request Testing? ...................................................................................71
�
2. Evidentiary Issues ...................................................................................................................71
�
3. DNA Collection — Databanks of Convicted Person DNA .......................................................71
�
4. DNA Collection — Taking DNA From an Arrested Person by Judicial Order ..........................72
�
5. DNA Collection — Taking DNA From an Arrestee Without a Warrant...................................74
�
6. Alternative Methods of Obtaining DNA Evidence — Consent................................................75
�
7. Alternative Methods of Obtaining DNA Evidence — Abandoned Property ............................76
�
8. Scientific Evidence Admissibility Standards............................................................................76
�
9. Motions in Limine — Statistics Issues...................................................................................76
�
10. Motions in Limine — Presence of the Defendant’s DNA in the Databank ..........................77
�
11. Motions in Limine — Hearsay, Confrontation and DNA Evidence.......................................78
�
12. Admitting Evidence...............................................................................................................79
�
Endnotes.....................................................................................................................................81
�

8

DNA Basics: Trial Issues ............................................................................................................... 91 

1. Getting Ready for Trial ............................................................................................................91
�
2. Trial Advocacy .........................................................................................................................92
�
3. DNA and the Jury....................................................................................................................92
�
4. Jury Selection .........................................................................................................................93
�
5. Opening Statement.................................................................................................................94
�
6. Witness Preparation................................................................................................................94
�
7. Objections During the State’s Direct Examination of a DNA Expert.......................................94
�
8. Taking Juror Questions During Testimony (If Allowed) ..........................................................95
�

vi

DNA

INITIATIVE

DNA BAsICs: tHE sCIENCE oF DNA

9. Effective Cross-Examination of a DNA Expert ........................................................................95
�
10. Special Considerations for Trying mtDNA Cases................................................................102
�
11. Special Considerations for Trying Y-STR Cases ..................................................................107
�
12. Voir Dire of the Prosecution’s DNA Expert .........................................................................109
�
13. Stipulations — Qualifications and/or Results ......................................................................110
�
14. Questioning Law Enforcement on Evidence Collection and Chain-of-Custody Issues .......110
�
15. Defense Expert Testimony Issues......................................................................................111
�
16. Defense Case — Stay on Theme........................................................................................111
�
17. Defense Counsel’s Closing Argument in a DNA Case........................................................112
�
18. The Prosecution’s Closing Argument in a DNA Case .........................................................112
�
Endnotes...................................................................................................................................113

9 Delayed Prosecutions, Cold Case Hits and CODIS ................................................................... 123 

1. Statute of Limitations Defenses ...........................................................................................123
�
2. John Doe Warrants ...............................................................................................................123
�
3. Due Process..........................................................................................................................123
�
4. The Databank Hit Case .........................................................................................................124
�
5. Review the Match Report Carefully......................................................................................127
�
6. Arizona Databank Matches and Use of Random Match Probability 

in Discovery Litigation ...........................................................................................................133
�
7. Identifying the Theory of Defense: Defenses Specifically Based on a Cold Hit ...................136
�
8. Statistics ...............................................................................................................................136
�
9. Contamination.......................................................................................................................136
�
10. When the Government Cannot Produce Certain Evidence.................................................137
�
11. Cases in Which No DNA Evidence Was Tested .................................................................137
�
Endnotes ..................................................................................................................................139
�
10 Proactive Uses of DNA................................................................................................................ 145 

1. Using DNA to Establish Third-Party Guilt ..............................................................................145
�
2. When to Seek Postconviction DNA Testing .........................................................................148
�
3. When Are You Entitled to Postconviction DNA Testing?......................................................158
�
Endnotes...................................................................................................................................162
�
Glossary ........................................................................................................................................ 167 


DNA

INITIATIVE

vii
�

CoNtENts

Exhibits
Table 1:

SWGDAM Guidelines for Mixture Interpretation (January 14, 2010) .................................. 47
�

Table 2:

Suitable Statistical Analyses for DNA Typing Results ......................................................... 69
�

Figure 1:

Nucleotide Base Pairs .......................................................................................................... 3 


Figure 2:

The DNA Double Helix .......................................................................................................... 4
�

Figure 3:

DNA in the Cell...................................................................................................................... 5
�

Figure 4:

Tagging Loci With Different Colors ....................................................................................... 7
�

Figure 5:

Epithelial Cell With Christmas Tree Stain .............................................................................. 9
�

Figure 6:

Kastle-Meyer Presumptive Test for Blood ............................................................................ 9
�

Figure 7:

Prostate-Specific Antigen (PSA) Confirmatory Test ............................................................ 10
�

Figure 8:

Sperm Cells With Christmas Tree Stain .............................................................................. 11
�

Figure 9:

Sperm Cells With Christmas Tree Stain .............................................................................. 11
�

Figure 10: A 16-Loci Single-Source Sample ......................................................................................... 45
�
Figure 11: Enlargement of Results at Three Loci, Single-Source Sample ............................................ 45
�
Figure 12: Portion of Electropherogram Depicting Degradation........................................................... 46
�
Figure 13: A 1:1 Mixture....................................................................................................................... 48
�
Figure 14: A 6:1 Mixture....................................................................................................................... 48
�
Figure 15: Restricted vs. Unrestricted Calculations ............................................................................. 51
�
Figure 16: Illustration of Normal Copying of Template Strand During PCR.......................................... 54
�
Figure 17: How Stutter Occurs ............................................................................................................ 55
�
Figure 18: Spike Artifacts ..................................................................................................................... 59
�
Figure 19: Dye Blob Artifacts ............................................................................................................... 59
�
Figure 20: Drop-out Artifacts ................................................................................................................ 60
�
Figure 21: Shoulder Artifacts................................................................................................................ 61
�
Figure 22: A Split Peak Artifact............................................................................................................. 61
�
Figure 23: Pull-up Artifacts ................................................................................................................... 61
�
Figure 24: Peak Height Imbalance........................................................................................................ 62
�
Figure 25: mtDNA Database .............................................................................................................. 105
�

viii

DNA

INITIATIVE

DNA BAsICs: tHE sCIENCE oF DNA

Appendixes*
Appendix A:	�Recommendations of the Kinship and Data Analysis Panel (KADAP) to the Office of
the Chief Medical Examiner of New York City During the World Trade Center DNA
Identification Effort
Appendix B:	� Sample Personal Items Submission Form
Appendix C:	� Sample Family and/or Donor Reference Collection Form
Appendix D:	�Sample Family Tree Form
Appendix E:	� Guidelines for Family and/or Donor Reference Collection Kit Components and
Oral Swab Collection Instructions
Appendix F:	� Issues to Consider When Outsourcing Reference Samples
Appendix G:	�Identifying Victims Using DNA: A Guide for Families
Appendix H:	�Sample Analysis: An Overview
Appendix I:	� Additional References on Statistical Issues in DNA Identification

*Appendixes A–I are only available electronically at nij.gov/pubs-sum/237975.htm.

DNA	

INITIATIVE

ix

CHAPTER 1

Introduction

You are defense counsel in a case with DNA
evidence or where the absence of DNA evidence
may raise factual or legal issues. DNA evidence,
when properly collected and analyzed, and when
relevant to an alleged crime, can have extraordinary value in the adjudication of a criminal case.
This notebook is designed to help defense
attorneys understand:
n

The biology of DNA.
�

n

Proper collection procedures for DNA 

evidence.

n

Interpretation of DNA analysis and findings.

n

When and why an expert is needed.

DNA

INITIATIVE

n		 Development

of case theory in a DNA-based
prosecution or in a case where there should
be DNA evidence.

n 	 Legal

issues for pretrial and trial in cases with
DNA evidence.

n 	 Postconviction

cases.

Terms that are in red in this notebook are defined
in the Glossary, page 167.

Note: DNA testing techniques used in criminal
cases have evolved over time. Peers should be
consulted to ensure that the most current, relevant and applicable information and case law
are being used.

­1

CHAPTER 2

DNA­Basics:­The­Science­of­DNA
Section­1:­What­Is­DNA?
Deoxyribonucleic acid (DNA) is sometimes called
a genetic blueprint because it contains all of
the instructions that determine an individual’s
genetic characteristics. A technical explanation of
DNA can be found at http://www.genome.gov/
glossary/index.cfm?id=48.

Where­does­nuclear­DNA­come­from?
Our parents. All human cells with a nucleus,
except gamete cells — egg and sperm cells
— have DNA containing the full complement
of 46 chromosomes. Each egg and sperm
cell carries half of the DNA complement
(23 chromosomes).
Mixing of genetic markers occurs across the
DNA molecule during the formation of sperm
cells and egg cells. Because of this mixing process, the DNA in all sperm cells from one man
or all egg cells from one woman are not equal
halves “split down the middle.” Rather, each
genetic characteristic has a 50% chance of
presenting itself in any given egg or sperm. In
humans, very few observable traits are due to
inheritance of only one gene. Most observable
characteristics are the result of the products
of multiple genes interacting. Although actual
inheritance of eye color is complex, the following example simplifies the concept of inheritance
of eye color for illustrative purposes. Consider
a male with brown eyes who inherited a brown
eye gene (B) from one parent and a blue eye
gene (b) from the other. His “eye genes” will be
depicted by geneticists as Bb. (Remember this
from high school biology?) Half of his sperm cells
will have the B (brown) gene, and half will have
the b (blue) gene. Simplistically, the color of his
children’s eyes will be dictated by two factors:
what gene he gives them and what gene their
mother gives them. If the mother likewise has

DNA

INITIATIVE

brown eyes and carries a Bb profile, their children
will statistically be expected to look like this: 25%
BB (brown eyes), 25% Bb (brown eyes), 25% bB
(brown eyes), and 25% bb (blue eyes). Each of
these four profiles reflects the different possible
combinations given the genetic characteristics of
the original DNA of dad and mom.

What­is­DNA­made­of?
DNA is found in the cells of all living organisms,
except red blood cells. DNA is actually a combination — called a DNA sequence — of four
bases: adenine, cytosine, guanine and thymine,
commonly referred to as A, C, G and T (see

Figure­1:­Nucleotide­Base­Pairs

Source: Christine Funk, Working Group Member.

3­

CHAPTER 2

Figure 1). These four bases, in varying combinations, make up yeast, bananas, chickens, rice and
people as well as all other living organisms.

Figure­2:­The­DNA­Double­Helix­

The principle of sequence formation is not unlike
the principle of the English language. The 26 letters in the alphabet (or the four bases in a DNA
sequence) can be combined in various ways to
make different words. “The” and “theory” have
three letters in common — both in the specific
letters used and the order of the first three letters. Yet the word “the” has no application to
the word “theory.”
Likewise, in music, there are 12 elements: seven
notes (A, B, C, D, E, F and G) and five sharps or
flats. Playing these notes in different combinations creates “The Flight of the Bumblebee,”
Pachelbel’s “Canon in D” and the theme song to
“Charlie Brown.”
With DNA, instead of 26 or 12 elements, there
are the four bases mentioned above. Just as the
combination of notes dictates what the music
sounds like and the combination of letters dictates the word, the combination of As, Cs, Gs
and Ts dictates the type of living thing.
The DNA of all human beings is actually nearly
identical. Approximately 99.9% of the sequence
of As, Cs, Gs and Ts is in the exact same order.
This determines common human features such
as two eyes, ears on both sides of the head,
and long bones in forearms and calves. Although
looking at these parts of the DNA molecule
might help us determine it is human DNA —
rather than, say, banana DNA — it isn’t helpful
in distinguishing one human from another.
There are, however, places on the human DNA
molecule that are different. Of the approximately
3.2 billion base pairs in the human genome, a
forensic DNA-typing test looks at about 3 thousand base pairs where there are known differences between people.

What­is­a­base­pair?
Picture the DNA molecule as a spiral staircase
(see Figure 2). The bases A, C, G and T behave in
a predictable pattern of matching and becoming
base pairs. A base pair is simply a pair of bases.

­4

Source: John Butler, National Institute of Standards
and Technology.

Bases pair up to form the “steps” of the DNA
molecule. The sides of the DNA molecule are
made up of sugar and phosphate chains.
Our interest is in the bases themselves. Imagine
straightening out the DNA molecule to make a
ladder rather than a spiral staircase. Each step
of the ladder is a single base pair. As indicated
above, there are about 3.2 billion base pairs
in the DNA molecules comprising each set of
human chromosomes.
Each base pair consists of either an A matched
with a T, a T matched with an A, a C matched
with a G, or a G matched with a C. That’s it.
Those are the only four combinations of base
pairs that exist. Bases that pair with each other
are called complementary bases.
These base pairs, about 3.2 billion strong, represent a whole DNA molecule or what is referred
to as nuclear DNA (nDNA). All cells in the body
contain DNA, except for red blood cells, which
do not have a nucleus. DNA in blood comes from
the nuclei of white blood cells.

DNA

INITIATIVE

DNA BASICS: THE SCIENCE OF DNA

Figure­3:­DNA­in­the­Cell

Source: John Butler, National Institute of Standards and Technology.

Back­to­high­school­biology
Picture a chicken egg. An egg is like a cell,
except that an egg’s outer shell is smoother and
more symmetrical than a cell’s outer shell or
membrane. The yolk of the egg is comparable to
the nucleus of a cell. The DNA is located inside
the nucleus (see Figure 3). The DNA in a single
cell is over 6 feet long and is bunched up inside
the nucleus of each of our nucleated cells. In
order for DNA analysts to be able to conduct testing on DNA, they must remove the DNA from the
other cellular material that is present, using a process called DNA extraction or DNA isolation.
Human traits are determined by the particular
order of the bases. The first thing the order dictates is that we are human. Second, the order
of the base pairs dictates all the physical traits
we are born with (such as eye color, face shape,
etc.). In addition, there are base pairs that do
not “code” for anything and pairs whose coding
functions are not yet known.
The DNA looked at in forensic science is not
currently known to have any function (such as

DNA

INITIATIVE

coding for eye color or the potential predisposition toward a genetically inherited disease)
— except for amelogenin, which is used in
forensic analysis for gender differentiation.
The areas at which forensic analysts look are
always found in the same spots on the same
chromosomes. Each specific location is called a
locus (pronounced “LOW-cuss”). The forensic
science community typically uses a minimum
of 13 genetic loci (plural for locus, pronounced
“LOW-sigh”), referred to as the 13 core CODIS
(Combined DNA Index System) loci. This enables
laboratories to search profiles against other profiles already in the CODIS databank (although
some laboratories test more than the 13 core
CODIS loci). Throughout this training guide, references will be made to the 13 core CODIS loci.
These core CODIS loci are CSF1PO, D3S1358,
D5S818, D7S820, D8S1179, D13S317, D16S539,
D18S51, D21S11, FGA, THO1, TPOX, and VWA
(TPOX is pronounced “T-Pox.” VWA is pronounced V.W.A. Likewise, FGA and CSF are simply pronounced by their individual letters. THO1
is pronounced “Tho One,” with a hard “th.”).

5­

CHAPTER 2

For the “D” loci, the number following the D
(which stands for DNA) indicates the chromosome on which each locus is found. D21S11,
for example, is a complete name, which lawyers
refer to as D21 for identification. Here “21”
refers to the 21st chromosome, S corresponds
to the word “single” — meaning there is only
one copy of this genetic marker in the human
genome, and the number following the S refers
to where this locus is found on the 21st
chromosome.
Each of the 13 loci was chosen because of its
high degree of polymorphism, meaning that
several different possible genetic types exist for
each locus. By examining and identifying these
differences, scientists in the laboratory can differentiate between people. To illustrate, the locations on the DNA molecule that dictate for the
nose to be in the center of the face are essentially identical among us all. On the other hand,
the genes that dictate the shape of one’s nose
are polymorphic. All you have to do is look at 10
people to know that.
At each core CODIS locus, the possible types
one can have are labeled by number. At THO1,
for example, the types that have been observed
are 5, 6, 7, 8, 9, 9.3, 10 and 11. Generally, each
person on the planet has two of these: one from
mom and one from dad. These types are referred
to as alleles (pronounced “uh-LEELS”). If the two
alleles in a profile are identical (in other words,
the person received a 5 from mom and a 5 from
dad), they are homozygous. If the two alleles are
different, say, a 5 from mom and an 8 from dad,
they are heterozygous at that locus. Rare mutations can and do occur (see, for example, www.
cstl.nist.gov/biotech/strbase/).

So what’s a 9.3? Although most of the time
the DNA we are looking at involves a repeating
pattern of four base pairs, sometimes — 9.3 at
THO1, for example — this is not the case. We
already know that, at this locus, nine repeats of
AATG constitute a 9 allele type and 10 repeats
make a 10 allele type. A 9.3 reflects nine repeats
of AATG and an additional three bases minus one
of the As, ATG. If there was an additional A in the
same predictable pattern, we’d call it a 10, but
because some people have ATG in addition to
nine repeats of AATG, an allele type of 9.3 exists.
Not every locus has the repeating pattern of
AATG, but every STR locus does have a repeating pattern of base pairs that we look for to identify the allele types for that particular locus.

Short­tandem­repeats­(STRs)

How­are­loci­of­interest­found?

The numbers identifying the alleles for the core
CODIS loci reflect the number of repeated base
pair sequences at that locus. Remember, the
locus is polymorphic — it varies from person to
person. The way it varies is in its length. A person who has a type 5 has a much shorter length
of DNA at that locus than a person who has a
type 10.

Let’s continue to use THO1 as an example. We
know it is on the 11th chromosome, and we
know where it is on the chromosome. In the
lab, DNA test kit reagents are combined with
a portion of the DNA obtained from a sample.
The reagents have several jobs. One is locating
the areas of interest (the loci) that we wish to
test. Primers run along the strands of the DNA
molecule, looking for the loci we care about. The
primers then identify the DNA strand immediately before and immediately after the region of

For example, at THO1, we are not just looking at the 11th chromosome; we are looking

­6

for a pattern at a specific location on the 11th
chromosome. The pattern looks like this: AATG.
We know that everybody has the same AATG
sequence on the DNA molecule at THO1. The
difference between individuals is how many
times the pattern AATG is repeated on both of
their 11th chromosomes. Some people have a
pattern of the four bases AATG repeated five
times, and their DNA type, or allele, for that copy
of their 11th chromosome would look like this if
it was sequenced by bases: AATGAATGAATG
AATGAATG. Other people, however, have other
alleles — and the person with five repeats on
one of their 11th chromosomes may have a
completely different repeat on their other 11th
chromosome. For example, the sequence AATG
AATGAATGAATGAATGAATGAATGAATGAATG
shows the pattern of four base pairs repeating
nine times. This allele type is a 9. If one additional four-base-pair pattern were repeated, the allele
type would be a 10.

DNA

INITIATIVE

DNA BASICS: THE SCIENCE OF DNA

interest. Think of these areas as the bookends
framing the loci. They are called primer binding
sites.
In addition to identifying the DNA molecule
before and after the locus, the polymerase chain
reaction (PCR) takes place. PCR is a process
where potentially billions of copies of the DNA at
the locations of interest are made. Some forensic
scientists liken this to molecular Xeroxing. How
is this done? A tube or well — containing the
forensic sample (DNA), the primers for the primer binding sites with fluorescent dyes attached,
additional bases, and an enzyme to replicate the
DNA — is heated. This causes the DNA molecule
to split into two strands. Recall our image of the
DNA molecule as a straight ladder? The rungs
of the ladder are pairs of bases bound together
in a very specific way. Bases behave in predictable patterns — A goes with T, T goes with A, C
goes with G, and G goes with C. Now imagine
that each rung is broken in half, resulting in two
half-ladders. If we have half of a ladder, we have
a long string of bases without their base pairs.
When we cool the test tube down, the bases will
seek to pair with their partners. At a high temperature, the DNA strands will stay apart. At a lower
temperature, the primers will bind to their corresponding complementary bases on the original
DNA strands. At a slightly higher temperature,
copies of the DNA are made by the enzyme
that replicates the DNA, adding complementary
bases to each of the single DNA strands.
Again, let’s use THO1 as an example. On one
side of the ladder is an AATG pattern. A T base
will pair up with the first A base when the temperature is right. Again, a T base will bind to its
complementary base (the second A), an A with
the T, and finally, a C across from the G. So,
where we once had a single strand of DNA, following a single round of heating and cooling with
PCR, we have two copies of the strand.
As the PCR process continues, we heat up the
sample and reagents again and the strands split
again; cool it down and the primers bind; heat it
up a little more and additional bases in the tube
bind in that same predictable pattern. The yield
after two PCR cycles is, therefore, four copies of
the areas of the original DNA strand in which we
are interested.

DNA

INITIATIVE

Of course, we don’t start with one cell’s worth of
DNA (about 6 pictograms) because a minimum
of roughly 16–32 cells is needed (approximately
100–200 pictograms) to get reproducible results.
For optimal results, many commonly used DNA
kits recommend that 0.5–1.0 nanogram of DNA
(500–1,000 pictograms or about 80–160 cells)
should be used. Because sperm cells carry only
half the genetic information of other nucleated
cells, twice as many (or 160–320 sperm cells) are
needed to achieve a target of 0.5–1.0 nanogram
of DNA. Newly designed kits seek to generate reproducible results while using a smaller
amount of sample DNA.
This process of heating and cooling takes place
in a thermal cycler and is done approximately 30
times (this will vary, depending on the kit used
by the laboratory and their validated protocol). At
the end of the process, there are literally billions
of copies of areas of interest.
For a technical explanation of the PCR process,
go to https://amplification.dna.gov/m01/01/ (free
registration required). Once we have a large
number of copies, the generated DNA pieces or
fragments are separated by size. The most commonly used method for separation is via the use
of a capillary electrophoresis (CE) instrument. A
capillary (shaped like a very thin straw) is inserted
into a tube or well and draws out a small amount
of the amplified product mixture. The DNA travels up and through the straw in a predictable
manner — smaller DNA fragments moving faster
than larger DNA fragments. Once a piece of DNA
reaches the end of the capillary, it passes over
a laser light. This excites the fluorescent dye
incorporated during the PCR process and causes
the bound dye to fluoresce (light up). A camera
captures and measures the emitted light, which
is reproduced in the corresponding dye color
in an electropherogram (see Figure 4). It takes

Figure­4:­Tagging­Loci­With­Different­Colors

Source: John Butler, National Institute of Standards and Technology

7­

CHAPTER 2

approximately 20–30 minutes for all of the DNA
to pass through the capillary.
Not only does each locus contain DNA fragments
of varying sizes (for example, a 5 at THO1 is shorter than a 9.3 at THO1), but the DNA fragments for
each locus also vary in size. D3 alleles, for example, range from about 120 base pairs to 150 base
pairs. By contrast, CSF alleles range from about
305-360 base pairs. Because shorter fragments
of DNA travel faster than longer fragments, all D3
alleles come across the laser light well before any
of the alleles from CSF.
Some loci do overlap in size. If, for example,
there are three loci that overlap, they are tagged
with different dye colors to avoid confusion in
interpretation of the electropherogram. When the
alleles come across the laser light, the color as
well as the length of the fragment is recorded.
The color of the alleles, along with their length,
indicates which alleles go with which other
alleles as well as what locus they come from.

Section­2:­Where­Is­DNA­Evidence­
Found?
Where is DNA evidence found? The short
answer: essentially everywhere. As forensic scientist Keith Inman put it, “The world is a messy
place.”
The obvious places are blood, semen, hair pulled
from the body, skin and saliva. Many times these
stains are obvious, but DNA exists in other places. DNA can be found on cigarette butts, the lips
of beer bottles, and envelopes that were licked
before they were sealed. DNA can be found on
surfaces that were touched, such as a counter,
a phone or a gun. It can be found on clothing —
again, both the obvious, such as the crotch of a
pair of underwear, and the less obvious, such as
the collar or underarms of a shirt, the waistband
of a pair of shorts, socks, and the headband of a
baseball cap. It can be found on pens, particularly
those that have been used for any length of time
or put in someone’s mouth. A used toothbrush is
an excellent source of DNA, as can be chewing
gum or spit on the ground. A rather famous case
in Cook County, Ill., was solved by obtaining DNA
from chicken bones — not chicken DNA, but the
DNA of the person who ate the chicken off the
bones.

­8

Serology/body­fluid­stain­testing
The term serology is used by many forensic laboratories to refer to the initial examination of items
of evidence to test for the presence of biological
materials and/or to recover portions of samples
for DNA testing. Serologic testing can be used
to indicate or identify the presence of a particular body fluid — such as blood, saliva, semen or
urine — in the investigation of a crime. A serologist may also visually examine hair, teeth, bone,
tissue and skin cells by using a microscope.
Biological stains in the dried state are reasonably
stable and can be detected months or years after
being deposited.
Understanding serology is critical, as proper
serologic testing may identify the type of body
fluid comprising a stain from which a DNA profile was generated. If, for example, a stain on
an item of clothing is at issue, knowing whether
the male DNA present in the stain is from saliva
versus semen can radically impact the context
of the case and the nature of the defense. For
this reason, defense counsel must be aware
of the differences between presumptive and
confirmatory/conclusive tests (see below) and
must understand which were used in a particular
investigation.
Lawyers often focus on the DNA evidence in a
case, neglecting to pay attention to the type of
biological evidence from which the DNA profile
was generated. The positive identification of a
stain as originating from a particular body fluid
may be probative evidence in itself and important
in developing the case theory regarding what
happened and how it happened. For example, a
DNA sample, taken from the nightdress of a child
living in an extended-family home and matching
a cohabiting male suspect, may provide profiles
with different degrees of probity, depending
on whether the source of the DNA is saliva or
semen.

Presumptive­versus­confirmatory­tests
Serologic tests can be classified as presumptive
or confirmatory.
Presumptive tests are often used for bulk or
rapid screening of evidence. A positive presumptive test suggests the presence of a particular

DNA

INITIATIVE

DNA BASICS: THE SCIENCE OF DNA

body fluid. Because of the possibility of false
positive reactions, however, a presumptive test
is not conclusive.
To positively determine the presence of a particular body fluid, a confirmatory test — with a
high degree of specificity for the body fluid in
question — must be performed. For some body
fluids, such as vaginal secretions, most labs do
not use a confirmatory test.
If a confirmatory test was not conducted in a
case, defense counsel should determine why,
whether it might still be requested, and how
this could impact the theory of the case. Most
often, a confirmatory test is not done because
there is no currently available test that can definitively identify a body fluid, or the test has not
been validated by the lab. Sometimes, however,
confirmatory testing is not done because of lab
protocol, limited sample size or lack of resources.
Be aware that there are documented examples
of examiner or laboratory neglect resulting from
the failure to conduct a confirmatory test or to
correctly report what serologic testing was
conducted.
See Figures 5 through 9 for examples of various
analyses used in presumptive and confirmatory
tests for epithelial (skin) cells, blood, semen and
sperm cells.

Figure­5:­Epithelial­Cell­With­Christmas­­
Tree­Stain

Source: Palm Beach County Sheriff’s Office.

DNA

INITIATIVE

Blood
The common presumptive tests for blood are
phenolphthalein (Kastle-Meyer reagent; see
Figure 6), leucomalachite green (LMG), o-tolidine
and tetramethyl benzidine (TMB), which cause
color changes that indicate the potential presence of blood. These tests are considered presumptive because human blood, animal blood,
oxidizing agents (such as rust) and plant extracts
can all show a positive reaction.
Another presumptive test called luminol
(3-aminopthalhydrazide) is typically used to
screen large areas for the presence of blood
that is not visibly detectable. In the presence
of blood, luminol glows in the dark; however, a
common household item such as bleach may
also give a positive reaction.
There are currently two types of confirmatory
tests for blood — crystal tests and antibodyantigen tests. Crystal tests, such as the Takayama test, are specific for hemoglobin, a protein
found in blood; however, these tests cannot
determine whether the blood is human or animal. An example of the antibody-antigen type
of confirmatory test for blood is the widely used
ABAcard® HemaTrace® test for the Identification

Figure­6:­Kastle-Meyer­Presumptive­Test­­
for­Blood

Source: Palm Beach County Sheriff’s Office.
�
Note: Positive test is pink, and negative test has no color 

change.
�

­
9

CHAPTER 2

of Human Hemoglobin. The HemaTrace® test (an
immuno-chromatographic lateral-flow test strip)
is used as a confirmatory test for human blood,
although it gives a positive reaction with the
blood/hemoglobin of other higher primates and
has been reported to react with ferret blood. The
Rapid Stain Identification of Human Blood (RSIDBlood) test is another immuno-chromatographic
lateral-flow test-strip device. The RSID-Blood test
detects a component of the human red blood cell
membrane called human glycophorin A antigen;
it purports to be specific for human blood and
has no cross-reactivity with other species. More
extensive validation studies are ongoing.

Semen
Semen is a mixture of sperm cells (spermatozoa)
and seminal fluid. Seminal acid phosphatase
(SAP) is an enzyme present in high concentrations in semen. SAP (or AP) is a presumptive test
for semen that causes a color change indicating
the potential presence of semen. Other body fluids (such as vaginal fluid) also contain AP in lesser concentrations and can give positive results.
Visual observation of sperm cells under a microscope confirms the presence of semen. The
Christmas tree stain is an example of a histological stain used to color the sample for ease in
visualization. With this stain, under a compound
bright-field light microscope, sperm heads are a
deep neon-like pink/red with pale pink, almost
colorless tops (acrosomal caps) (see Figure 8).
When sperm tails are present, the area that
connects to the sperm head (the neck and midpiece) stains a pale bluish green, whereas the
remainder of the tail stains pale green. Epithelial
cells appear as pale bluish green with red to
purple nuclei (see Figure 5). An expert should be
consulted regarding the significance of the presence or absence of sperm tails.
Another way to confirm the presence of semen
is to test for p30, also called prostate-specific
antigen (PSA), a male-specific protein. This
can be done with the use of an immunochromatographic lateral-flow test strip such as
the ABAcard® p30 test for the Forensic Identification of Semen (see Figure 7), via an enzymelinked immunosorbant assay (ELISA) test, or by
using another immunoassay procedure. Another
confirmatory test for semen is the RSID-Semen

­10

test, which detects two semenogelin proteins,
other male-specific proteins found in high quantities in seminal fluid. Tests for male-specific
proteins can be particularly useful in detecting
seminal fluid from males with no sperm cells or
a reduced number of sperm cells (e.g., vasectomized, azoospermic or oligozoospermic males).
Given current DNA methodologies, some laboratories use the differential DNA extraction process
to confirm that sperm cells are present in a sample. The differential extraction process uses the
differences in the properties of sperm cells and
epithelial cells to attempt to separate the two
cell types. The ability to obtain a single (or major)
male DNA profile in the designated male (sperm)
fraction, particularly when a single (or major)
female DNA profile is obtained in the corresponding female (nonsperm/epithelial cell) fraction, can
be interpreted to definitively state that sperm
cells were present in the tested sample.

Figure­7:­Prostate-Specific­Antigen­(PSA)­
Confirmatory­Test

Source: Palm Beach County Sheriff’s Office.

DNA

INITIATIVE

DNA BASICS: THE SCIENCE OF DNA

Figure­8:­Sperm­Cells­With­Christmas­Tree­
Stain

The most commonly used presumptive tests
for saliva involve the detection of alpha-amylase
(α-amylase). Significant levels of alpha-amylase
are strongly indicative of the presence of saliva.
Examples of amylase tests include the Phadebas,
radial immunodiffusion, and RSID-Saliva assays.
Currently, there is no confirmatory test for the
positive identification of saliva. Research is ongoing in an effort to develop an affordable confirmatory test.

Urine

Source: Palm Beach County Sheriff’s Office.
Note: Sperm heads appear in pink.

Figure­9:­Sperm­Cells­With­Christmas­Tree­
Stain

When the need arises to test for urine, presumptive testing for the presence of urea and/or creatinine — two substances found in large amounts
in undiluted urine — can be conducted. Another
test for urine is the RSID-Urine assay that tests
for Tamm-Horsfall protein, which is also found in
urine in large amounts.
Currently, there is no confirmatory test for the
positive identification of urine. Research is ongoing in an effort to develop an affordable confirmatory test.

Epithelial­(skin)­cells
Our epithelium covers most of the internal and
external surfaces of our bodies. Any cells from
the epithelium are referred to as epithelial cells.
When discussed in a forensic setting, epithelial
cells typically originate from the outer surface
of the skin or a body cavity such as the vagina,
mouth or rectum.

Source: Palm Beach County Sheriff’s Office.

Saliva
Saliva can be found in a variety of places at crime
scenes. Some of the most common sources are
discarded cigarette butts and drink containers.
Saliva is also commonly found in sexual assault
cases that involve oral contact; it is often mixed
with other body fluids such as vaginal secretions
or semen.

DNA

INITIATIVE

From a practical perspective, DNA testing is
commonly conducted on items believed to contain skin cells shed from the external surfaces
of our bodies. Further, it is not uncommon to
hear someone refer to a DNA profile as being
obtained from “sweat.” In reality, any DNA taken
from areas on which someone has left sweat is
from the person’s epithelial cells — there are no
commonly used screening tests to indicate the
presence of sweat.
The microscopic appearance of epithelial cells
from different areas of the body can vary. However, given that most forensic biology examinations involve reconstitution of dried body fluid

­
11

CHAPTER 2

deposits, which can affect the microscopic
appearance of a cell, most forensic laboratories
do not seek to identify the origin of epithelial
cells by using a microscope.

Serology­validation­studies
It is unlikely that the testing lab will possess
internal validation studies for the classic presumptive and confirmatory serologic tests, such
as Kastle-Meyer, acid phosphatase, Takayama,
and so on, because these are long-established
testing processes that would have been in use
well before validation requirements for testing
procedures were put in place. However, the lab
must be able to reference each test they are
using to the scientific literature.
The lab should have performed internal validation studies on the more recently developed and
adopted tests, such as the ABAcard® HemaTrace® and p30 assays, and the RSID™ range of
products, to demonstrate their robustness, reproducibility and reliability. These validation studies
should be available for review.

Section­3:­What­Are­the­Basic­Steps­
in­DNA­Typing?
Following the processing of items of evidence
to obtain samples for DNA testing, there are five
basic steps to follow during DNA typing:
■■

Extraction of DNA from cellular material.

■■

Quantification of the amount of human DNA
recovered.

■■

Amplification of the areas of DNA being tested
using PCR.

■■

Separation and typing of amplified DNA
fragments (typically using capillary electrophoresis, or CE).

■■

Review, interpretation, comparison and
reporting of typing results.

Section­4:­What­Are­the­Categories­
of­DNA­and­DNA­Tests?
Nuclear­DNA

Serology­interpretation­guidelines:­­
A­must­for­each­test
The lab must have interpretation guidelines for
every test result (both presumptive and confirmatory). The interpretation guidelines are found in
the laboratory’s protocol/procedure documents.
Interpretation guidelines may vary from lab to
lab; however, the lab must demonstrate that
its body fluid test worked properly at the time
it was used for the samples at issue in a case.
This is often done by demonstrating the appropriate reactions of positive and negative control
samples. A positive control contains a known
sample of the body fluid that is being tested for
(e.g., blood) and must give a positive test result.
A negative control is a sample that is known to
not contain any of the body fluid being tested for
and must provide a negative test result. Defense
counsel should ensure that the lab followed its
defined interpretation guidelines during testing
procedures.

­12

Nuclear DNA (nDNA) is found in the nucleus of a
cell, packaged in chromosomes. The nucleus of
a human cell contains 23 pairs of chromosomes
(46 total), half of them inherited from each parent. One notable exception is that each individual
sperm contains only 23 chromosomes (1 pair);
forensic scientists look at multiple sperm, which
collectively provide a testing result that represents the full complement of 46 chromosomes.
Every individual — except for identical twins —
has a unique autosomal short tandem repeat
(STR) nDNA profile.

Short­tandem­repeats
Autosomal nDNA testing uses STR technology
as the basis for local, state and national DNA
databank entries. STR testing examines regions
of the DNA molecule that tend to repeat themselves in short, adjacent, or tandem segments.
Autosomal STR technology has a very high
degree of discrimination. “Multiplex” STRs
are groups of genetically independent STR

DNA

INITIATIVE

DNA BASICS: THE SCIENCE OF DNA

markers that can be examined at the same time.
The conventional or most commonly encountered type of STR testing is conducted on loci
found on autosomal (non-sex determining)
chromosomes. Accordingly, this testing is sometimes referred to as autosomal STR analysis,
testing or typing. See https://forensic.dna.gov/
module4/1/011/ for a graphic of an STR sequence
(free registration required).

Mini-STRs
Mini-STRs correspond to shorter sequences of
DNA than those occurring in conventional autosomal STRs. Mini-STRs target some of the same
regions as the 13 CODIS STRs but have been
redesigned to amplify smaller portions of the
DNA strand, which are used when conventional
autosomal STR testing is not possible because of
DNA degradation.

Amelogenin­(gender­typing)­testing
When the amelogenin locus (found on sex chromosomes in the nucleus) is tested, the gender
of the sample donor may be determined. Generally, females type as XX and males type as XY.
Amelogenin data may aid in interpretation of a
mixture containing both male and female DNA.
See https://forensic.dna.gov/module6/3/005/ for
an image depicting the difference between amelogenin typing results from a female and a male
(free registration required).

Low-quantity­template­DNA­testing
Low-quantity template DNA testing, also referred
to as low copy number (LCN) DNA testing, is
sometimes defined as typing of samples that
contain less than 0.1 nanogram (100 pictograms)
of sample DNA. Recall that existing protocols
typically recommend using 0.5–1.0 nanogram
of DNA to generate a complete autosomal STR
DNA profile. Another definition is that LCN typing
is the analysis of any results below the stochastic threshold for normal interpretation — in other
words, if the results fall outside of the laboratory’s defined peak height ratio norms, then the
typing result in question is defined as being LCN.
LCN typing has also been defined as typing a

DNA

INITIATIVE

sample with less than 0.2 nanogram of DNA or
as an increase in amplification cycles.
Use of the term low copy number has become
more precise over time. It is important to note
that there is a lack of consensus in the scientific community regarding the use and meaning
of this term. From a practical perspective, this
means you should not assume how LCN is being
used — and it may be important to put its use in
historical perspective.
Given the lack of clarity of the term low copy
number, there is a move to use the more precise
terms of either low-quantity template samples or
low-level DNA samples. Low-quantity template
samples are those that exhibit stochastic effects.
Stochastic effects are defined by the Scientific
Working Group on DNA Analysis Methods
(SWGDAM) as the observation of intralocus peak
imbalance and/or allele drop-out resulting from
random, disproportionate amplification of alleles
in low-quantity template samples.

Y-STRs
Y-chromosome DNA is inherited from the paternal parent. Essentially, fathers pass down their
Y-STR DNA profile to their male offspring, from
generation to generation, without a change in the
profile (barring mutation).1 Every male in a paternal lineage — fathers, sons, brothers, uncles,
and first, second, third and fourth cousins as
well as widely dispersed male relatives — will
share the same Y-STR profile. In simple terms, all
members of the same paternal lineage have the
same Y-STR profile. Mutations in a male lineage
do occur, resulting in different Y-STR profiles, but
they are rare.
Just as maternal lineages can be tracked with
mitochondrial DNA (mtDNA), paternal lineages
can be tracked with Y-chromosome markers.2
A Y-STR profile can be thought of as a “single
genetic locus” — as contrasted with the numerous independent loci available for traditional autosomal STR DNA typing. Because Y-chromosome
DNA does not undergo recombination (shuffling
of alleles) at each generation in the manner that
autosomal STR loci do, its discriminatory power
pales when compared with results of traditional
nuclear autosomal STR DNA typing.

­
13

CHAPTER 2

Y-chromosome DNA is found in the nucleus
of the cell, along with the autosomal (non-sex)
chromosomes from which the more commonly
encountered traditional STR profiles are derived.
The Y chromosome is found only in males, which
limits its application but also makes it particularly
attractive to scientists and law enforcement in
cases involving male and female DNA mixtures
that cannot be deconvoluted, and in cases where a
male profile is believed to be present but traditional
testing detects only female DNA. Because of these
types of issues, Y-STR DNA-typing kits have been
developed that detect only Y-chromosome markers. This allows a crime lab to isolate male DNA
that might otherwise have been overwhelmed
by the presence of female DNA or might have
gone undetected altogether. As such, Y-STR DNA
evidence is introduced most commonly in sexual
assault cases.3
A core set of locations on the Y chromosome
comprises a “minimal Y-STR haplotype,” which
has served as the basis of forensic applications
since 1997.4 In 2003, SWGDAM recommended
the use of both the minimal haplotype loci and
two additional Y-STR markers known as DYS438
and DYS439.5 Since that time, commercial kits
have been developed that allow for co-amplification of 12 Y-STR loci (PowerPlex® Y) and 17
Y-STR loci (Yfiler®); both kits include the minimal
haplotype loci and the additional loci recommended by SWGDAM.
As indicated above, the STR genetic markers on
the Y chromosome can be used to obtain the
genetic profile of the male donor(s) in mixtures
of body fluids from males and females. In mixture cases, when the concentration from the
female donor is very high compared with the
male contributor, the standard autosomal STR
analysis may fail to detect the DNA profile of the
male donor(s). When this occurs, Y-STR analysis
can be used to target the Y chromosome, and
the DNA from the female contributor is ignored.
Because Y-STR DNA typing is considered a tool
to augment autosomal STR results, crime labs
will typically conduct Y-STR typing on samples
either simultaneously with or subsequent to the
traditional autosomal STR DNA typing.
For example, the fingernail scrapings from a
female victim who has scratched her male assailant may benefit from Y-STR analysis because,
typically, most of the DNA recovered from under

­14

the victim’s fingernails will be her own, and the
male perpetrator’s component will generally
comprise a tiny fraction of the DNA present.
Unlike mixtures of sperm and nonsperm cells,
it is not possible to perform a differential DNA
extraction (a procedure that attempts separation
of the sperm cells from the nonsperm cells) of
mixed-source epithelial cells in fingernail scrapings. These types of cases are well suited to
Y-STR testing.
Other cases in which Y-STR analysis may be
useful include (a) sexual assaults involving saliva/
saliva and saliva/vaginal secretion mixtures and
(b) cases in which the interval between the incident and the collection of intimate samples from
the victim is greater than two days. In the latter
case, too few sperm cells may remain to obtain
a sperm-fraction DNA-typing result that does not
also contain the victim’s DNA profile (because
of the much larger proportion of donor DNA and
limitations of the differential extraction process).

Mitochondrial­DNA
Mitochondrial DNA (mtDNA) is found in the
cytoplasm of the cell, the area that surrounds
the nucleus. The mitochondrial genome is different from the nuclear genome and is distinct
in its size, variability and method of inheritance.
Perhaps the most significant distinction is the
manner in which mtDNA is inherited: Rather than
inheritance of randomly combined alleles from
both parents, mtDNA is passed unchanged from
the mother to all of her offspring. In the simplest
of terms, an exact copy of her mtDNA is passed
from a mother to her child. A man’s mtDNA is
inherited from his mother; he does not pass on
his own mtDNA type to his children.
This maternal inheritance pattern has two important implications in forensic testing. The first
implication is an advantage: The mtDNA of a
single maternal relative, even distantly related,
can be compared with the mtDNA from skeletal
remains and other forensic samples. The second implication is a disadvantage: mtDNA is not
a unique identifier. Because maternal relatives
share the same mtDNA type, the source of a
biological sample can never be conclusively identified with mtDNA. And, consequently, the discriminatory power of mtDNA pales in comparison
to that of nuclear autosomal STR DNA typing, as

DNA

INITIATIVE

DNA BASICS: THE SCIENCE OF DNA

all members of a given maternal line will share
the same sequence — barring mutations — from
generation to generation, future and past.6
As indicated above, mtDNA differs from nuclear
DNA in its storage location in the body. mtDNA
is found outside the cell’s nucleus in energyproducing organelles called mitochondria, where
a person’s entire mtDNA genome occurs in
abundance — up to thousands of individual, complete copies.7 Compare this to the singular set
of nuclear DNA found in the nucleus.8 Because
it is present in such dramatically higher quantities, mtDNA can often be detected when nuclear
DNA cannot.9
A person’s mtDNA sequence has approximately
16,569 base pairs in total, as compared with
nuclear DNA’s approximately 3.2 billion base
pairs.10 mtDNA also differs from nuclear DNA
insofar as most people are heteroplasmic with
respect to their mtDNA genomes, meaning that
they may have more than one mtDNA genome.
A person’s mtDNA sequence can differ at various locations within the body, from tissue type
to tissue type, or even within the same tissue.11
Certain bodily tissues, such as hair — often used
for forensic mtDNA analysis — tend to exhibit
higher levels of mtDNA variation than others.12
Some research suggests that the occurrence
of heteroplasmy in an individual increases with
age, whereas other data appear to contradict
that finding.13 Nonetheless, while the causes of
mtDNA heteroplasmy are not fully understood,
its existence has been widely observed and is
not disputed.14
mtDNA profiling was originally developed outside of the criminal justice context as a research
tool for population studies in various scientific
disciplines. Its relative integrity across generations proved to be an effective means of deriving
information about groups identified by a common
mtDNA sequence.15 Law enforcement adapted
the practice of mtDNA profiling — initially found
useful for the very fact that large groups of people share the same profile — as an inculpatory
tool to aid in criminal investigations.
The nature of mtDNA places limits on its forensic
adaptation, which a number of U.S. courts have
acknowledged.16 The relatively small mtDNA
genome consists of two primary regions, one of
which is a noncoding region and thus deemed

DNA

INITIATIVE

suitable for forensic use. The noncoding region
of the mtDNA genome regulates replication of
the mtDNA molecule and is known as the control region.17 The control region is typically 1,125
base pairs in length.18
To distinguish one person’s mtDNA from another, forensic scientists look at specific locations
within the control region that are known to be
highly variable among humans, as they do with
nuclear DNA. In the context of mtDNA, however,
only two such regions are currently used19 for
forensic identification because of their observed
variability from person to person: Hypervariable
Region I (HVI) and Hypervariable Region II (HVII).
Together, these two regions encompass a total
of only about 610 base pairs.20 An individual’s
mtDNA “profile,” or type, is a list of the differences between the sequences observed in the
two regions and those in a reference sequence
known as the revised Cambridge Reference
Sequence (rCRS).
These 610 bases, as previously noted, provide
something far short of the discriminatory power
of nuclear DNA, which has 13 routinely examined
distinct and genetically independent locations
that follow Mendelian genetic inheritance laws,
enabling them to be used to form the statistical
basis of compelling forensic identification evidence. Comparatively speaking, the typically 610
base pairs available for mtDNA analysis are tantamount to a “single genetic locus.”21
While both nuclear autosomal STR DNA and
mtDNA are routinely used for identity testing in
missing and unidentified persons cases, analysis
of mtDNA is considered most useful in traditional
forensic cases when nuclear DNA is insufficient
in quality or quantity to obtain a useful STR typing result. One reason for this is the multiple
copies of the mtDNA genome in cells discussed
above, which means there will be more copies of
the mtDNA to begin with. Another reason is that
the mtDNA genome is smaller than the nuclear
DNA genome, so it is more impervious to degradation. Shed body, head and pubic hairs with no
cellular material attached to the root and aged
skeletal remains are examples of samples analyzed for mtDNA because nuclear DNA of
sufficient quantity or quality is often not recoverable from these biological materials. See https://

­
15

CHAPTER 2

forensic.dna.gov/module8/1/003/ for an interactive exercise that explores the differences
between nuclear and mitochondrial DNA (free
registration required).

■■

Section­5:­Emerging­Technologies
Single­nucleotide­polymorphisms
Single nucleotide polymorphisms (SNPs) (often
pronounced “snips”) are the most common type
of genetic markers found in humans. SNPs can
play an important role in establishing ancestry
and, outside forensics, SNPs are often used to
identify genes involved in complex diseases.
SNPs can also be used to obtain results from
even smaller and more degraded DNA samples
than with STRs. Although the future utility of
SNPs is uncertain, it seems unlikely — due to
the limited variation of SNPs and difficulties with
mixed-sample interpretation — that this method
will replace STRs for routine DNA analysis. See
https://forensic.dna.gov/module15/1/003/ for an
example of an SNP sequence (free registration
required).

Plant­and­animal­DNA
Forensic DNA methods can conceivably be
applied to criminal cases for virtually any nonhuman source imaginable. Domestic cat and dog
DNA have been used in criminal cases, usually to
link a suspect to a pet. Specialized STR analysis
has been used when animal blood or hair with
adequate root material is available. STR analysis
provides nearly the same discriminatory power in
domestic animals as it does in humans, making
an STR match very powerful when animals are
involved.

See also https://forensic.dna.gov/module15/
3/002/ for information about the use of DNA
analysis and microbiology in the criminal justice
system (free registration required).

Section­6:­How­to­Find­Resources­
and­Stay­Current
Attorneys can keep current on forensic DNA
through a number of resources, including books
and websites for the beginner or seasoned
practitioner. Regional and national meetings
for attorneys offer training sponsored by public
defenders’ offices and professional associations.
Attorneys familiar with forensics can also attend
forensic science meetings and trainings such
as those sponsored by the National Institute of
Justice (www.nij.gov), the National Academy of
Sciences (NAS, www.nasonline.org), the American Academy of Forensic Sciences (www.aafs.
org), and the National Clearinghouse for Science,
Technology and Law (www.ncstl.org) — all good
resources to help stay abreast of the most recent
research and findings.
Some additional resources include:
■■

The President’s DNA Initiative (www.dna.gov).
Website has free online training and is an
excellent resource for laypeople.

■■

The National Legal Aid Defender Association
(www.nlada.org). Website has downloadable
forensic DNA articles, transcripts and protocols. Most materials are available to the public, although more confidential materials are
accessible only to criminal defense attorneys.

■■

Butler, J.M., Forensic DNA Typing: Biology,
Technology and Genetics of STR Markers, 2nd
ed., Burlington, MA: Elsevier Academic Press,
2005. A leading treatise on forensic DNA
(including diagrams).

■■

Two authoritative studies conducted by
National Research Councils (NRCs) of the

Here are some examples of how plant and
animal DNA can be used in the criminal justice
system:

­16

■■

Fur, feathers, bone, blood, urine, feces and
saliva may link an animal to a poacher or help
prove illegal importation of animal products,
such as pelts or tusks.

■■

Meat products may be traced to cattle with
mad cow disease.

Pods, seeds, leaves, bark and roots of illegal
plants or controlled substances (such as marijuana) may be present at a crime scene. Data
collected from plants constitute the newly
emerging field of forensic botany. See Arizona
v. Bogan, 183 Ariz. 506, 905 P.2d 515 (Ariz.
App. 1995).

DNA

INITIATIVE

DNA BASICS: THE SCIENCE OF DNA

NAS, including helpful language on the limitations of forensic DNA:
●■

●■

■■

■■

■■

■■

■■

DNA Technology in Forensic Science,
Washington, DC: National Academy Press,
1992, commonly referred to as NRC I.
The Evaluation of Forensic DNA Evidence,
Washington, DC: National Academy Press,
1996, commonly referred to as NRC II.

Buckleton, J., C.M. Triggs, and S.J. Walsh,
eds., Forensic DNA Evidence Interpretation,
Boca Raton, FL: CRC Press, 2005. An excellent resource for understanding calculations
used in forensic DNA evidence and explains
more complex problems in DNA statistical
analysis than most textbooks; offers approaches used and approved internationally, although
less frequently by U.S. crime laboratories.
Kreeger, L.R., and D.M. Weiss, Forensic DNA
Fundamentals for the Prosecutor: Be Not
Afraid, Alexandria, VA: American Prosecutors
Research Institute, 2003. Useful for defense
attorneys wanting to know what to expect
from prosecutors in DNA cases.
Forensic Bioinformatics Annual Conference:
Three-day seminar during August in Dayton,
Ohio. Less experienced attorneys can learn
how to litigate a DNA case, including introductory training in DNA testing, and comprehensive lessons on specific issues in cases
involving DNA. An advanced track is available
for more experienced attorneys (www.
bioforensics.com).
Moenssens, A.A., C.E. Henderson, and S.G.
Portwood, Scientific Evidence in Civil and
Criminal Cases, 5th ed., New York: Foundation
Press, 2007.
Payne-James, J., R.W. Byard, T.S. Corey, and
C. Henderson, Encyclopedia of Forensic and
Legal Medicine, Oxford, England: Elsevier
Academic Press, 2005.

Standard 11.2 of the Quality Assurance Standards for Forensic DNA Testing Laboratories,
effective July 1, 2009):
■■

Administrative information on the case, such
as agency, case identifier (e.g., file number),
evidence item numbers, victim name and suspect name.

■■

Date the report was issued and a signature
and title, or equivalent identification, of the
person accepting responsibility for the content of the report.

■■

A description of the evidence examined.

■■

A description of the technology or
technique used.

■■

Locus or amplification system used.

■■

Testing results and/or conclusions.

■■

A quantitative or qualitative interpretive
statement.

■■

Disposition of evidence.

Reports also may contain the results of any nonDNA tests (serology, for example) that were
performed to locate and characterize the type of
biological evidence.
Some laboratories include genotype data in their
reports, usually in the form of a table. As noted
above, reports must contain an interpretive statement, which will address whether a DNA profile
from an evidence sample can or cannot be associated with:
■■

A known individual (suspect, victim or third
party).

■■

Other evidence samples (scene samples or
sexual assault evidence).

■■

Databank samples (offenders, forensic
unknowns or missing persons).

Section­7:­Forensic­DNA­Lab­­
Report­Basics

If one or more of the known samples are consistent with any of the evidence samples, the report
must provide a statistical frequency or frequencies for the most probative finding(s).

Although there are national standards for reporting DNA analysis results, laboratories differ
regarding information included in their reports.
Basic elements that commonly appear include
the following (those in bold are required under

In addition to the laboratory analytical report,
other documents related to a case may be available. For example, the National DNA Standards
require laboratories to maintain a case file with all

DNA

INITIATIVE

­
17

CHAPTER 2

records related to case analysis and generated by
examiners. Case files commonly include:
■■

A chain of custody for items received by the
laboratory.

■■

Sketches or photographs taken in the
laboratory.

■■

Examination (“bench”) notes of any testing by
the analyst.

■■

Laboratory logs or standard forms related to
testing.

■■

Strips, photographs or copies of autoradiographic film or electropherogram data.

■■

Communication between the analyst and others involved in the case.

In addition to information in the case file, other
lab documents may include:
■■

Equipment calibration and maintenance
records.

■■

Analyst training and proficiency test records.

■■

Unexpected results or corrective action
reports.

■■

Quality assurance reports and audits.

Possible­DNA­report­conclusions
An inclusion, or DNA match, occurs when a
known sample is compared with an evidence
sample and the profiles are the same. An inclusion or a DNA match may also occur when all of
the alleles in a known sample are also found in
a DNA mixture profile. The significance of the
inclusion or match will depend on the statistical
data obtained. Some labs report this finding as
“cannot be excluded.”
When a known sample is compared with an evidence sample, the donor of the known sample is
excluded as a source of the evidence if the profiles are different. This is referred to as an exclusion (or a DNA nonmatch).
When an individual is excluded as the potential
source of DNA, it does not necessarily mean
the individual was not involved. For example, a
true perpetrator who left no detectable biological material will be excluded as a source of DNA.
Conversely, if an individual is a potential source

­18

of DNA at a crime scene, it does not necessarily
mean that the person was involved in the crime.
(See Section 2 of this chapter regarding alternate
explanations for the presence of DNA.)
Sometimes, no conclusion can be drawn as to
whether a known individual is included or excluded as the potential source of DNA evidence.
Inconclusive or uninterpretable results may be
due to complicating factors such as multiple contributors, contamination, degradation of samples,
or misinterpretation or misrepresentation of the
results.
Note: A defense attorney should seek an independent expert to review a laboratory’s finding of
inconclusive or uninterpretable results to determine whether, in fact, the opinion is supported
by the data, particularly when no results that support the defense theory of the case have been
reported.
Sometimes testing of a sample is attempted, but
no results are obtained. This could indicate:
■■

Absence of DNA in the sample.

■■

Insufficient DNA in the sample.

■■

Extensively degraded DNA.

■■

Presence of a substance that inhibits the PCR
process (PCR inhibitor), such as denim dyes,
carpet glue or certain types of latent print
powder.

■■

Improperly conducted or incomplete testing.

Note: Where initial testing produces no evidence
of DNA, consider sending the evidence for independent testing.
A threshold amount of amplified DNA must be
observed before a laboratory will report an allele
(a different form of a genetic marker at a particular locus) or genotype (the individual’s inherited
allele or alleles at a specific genetic marker, or
locus). The threshold (called a threshold value)
can differ among laboratories and is based on
internal validation studies used to establish
guidelines. Laboratory guidelines determine
whether — and under what conditions — data
under the threshold are reported. A laboratory

DNA

INITIATIVE

DNA BASICS: THE SCIENCE OF DNA

may have more than one threshold value based
on its validation studies. For example, it is not
uncommon for a laboratory to have different
threshold values for reporting homozygous and
heterozygous results.

Single-source­profile
DNA from one contributor is commonly referred
to as a single-source DNA profile. A single-source
profile could be derived from:
■■

A reference sample (victim or suspect).

■■

An elimination sample (first responders, EMT
personnel, consensual sex partners, or anyone
who might have had authorized access to the
crime scene).

■■

A crime scene or other evidence sample
(blood stain, chewed gum, cigarette butt).

contributor, although labs may differ in how they
report more than one profile detected in a
sample. See http://static.dna.gov/flash/6.3.003_
SteeringWheel.swf online for a report referencing a major DNA profile obtained from a small
amount of “touch” DNA.
Note: Counsel is advised to consult with an
expert regarding the interpretation and significance of classifying a contributor as major or
minor.

Endnotes
1. Butler, J.M., Forensic DNA Typing: Biology,
Technology, and Genetics of STR Markers 201
(2d ed., 2005).

More­than­one­source

2. Butler, supra note 1, at 201.

Mixtures of DNA from more than one contributor
are commonly encountered. A mixture could be
due to:

3. Id. at 201-03.

■■

Actual contribution by multiple donors during
the crime.

■■

Presence of DNA on the item prior to the
crime.

■■

Testing of intimate samples (e.g., vaginal
swabs or breast swabs).

■■

DNA added by handling an item after a crime
but before recovery (e.g., handling of a gun
used in a crime by a person(s) other than the
police).

■■

Contamination during crime-scene processing
and sample handling (collection, packaging or
testing).

Any biological material (blood, semen, saliva,
urine, hair, sweat and skin cells left behind after
contact) can be mixed and found in combination
with any other biological material.

Detecting­small­amounts­of­DNA
DNA can be detected in minute amounts.
Laboratory reports may classify certain profiles
as belonging to a major contributor or a minor

DNA

INITIATIVE

4. Id. at 207.
5. Id.; see Mulero, J.J., et al., “Development
and Validation of the AmpFISTER YFiler PCR
Amplification Kit: A Male Specific, Single Amplification 17 Y-STR Multiplex System,” 51(1) J.
F or e ns ic s ci. 64 (2006); Shewale, J.G., et al.,
“Y-Chromosome STR System, Y-PLEX 12,
for Forensic Casework: Development and
Validation,” 49(6) J. F or e ns ic s ci. 1278 (2004).
6. The mutation rate for mtDNA, however, is significantly higher than that for nuclear DNA.
7. The average has been estimated at approximately 500 copies for most cells. See Satoh, M.,
and T. Kuroiwa, “Organization of Multiple Nucleoids and DNA Molecules in Mitochondria of a
Human Cell,” 196 e xp . c e ll r e s . 137 (1991).
8. There are technically two “copies” of nuclear
DNA in the nucleus of a cell — one from the
mother and one from the father — but each
“copy” comprises only half of the set required
for forensic typing.
9. Butler, supra note 1, at 241.

­
19

CHAPTER 2

10. Butler, supra note 1, at 242.
11. See Buckleton, J., S. Walsh, and S. Harbison,
“Nonautosomal Forensic Markers,” in Buckleton,
J., C.M. Triggs, and S.J. Walsh, eds., Forensic
DNA Evidence Interpretation at 304 (2005).
12. Grzybowski, T., “Extremely High Levels of
Human Mitochondrial DNA Heteroplasmy in Single Hair Roots,” 21 e le ctr ophor e s is 548 (2000).
13. Buckleton et al., supra note 11, at 305.
14. See Buckleton et al., supra note 11, at 303;
D’Eustachio, P., “High Levels of Mitochondrial
DNA Heteroplasmy in Human Hairs by Budowle
et al.,” 130 F or e ns ic s ci. i nt . 63 (2002) (“Major
unresolved issues include the molecular mechanisms responsible for the occurrence of heteroplasmy to different extents in different tissues.”).
15. See, e.g., Wallace, D.C., “Mitochondrial
Disease in Man and Mouse,” 283 s cie nce 1482
(1999); Shriver, M., and R. Kittles, “Genetic
Ancestry and the Search for Personalized Genetic Histories,” 5 n atur e r e v . G e ne t . 611 (2004);
Cann, R.L., et al., “Mitochondrial DNA and
Human Evolution,” 325 n atur e 31 (1987).
16. See, e.g., Vaughn v. State, 646 S.E.2d 212,
214 (Ga. 2007) (observing that “mtDNA analysis
is more applicable for exclusionary, rather than
identification, purposes,” but admitting evidence

­20

nonetheless); Wagner v. State, 864 A.2d 1037,
1045 (Md. App. 2005) (“mtDNA analysis provides
significantly less ability to discriminate among
possible donors than does nuclear DNA analysis
and has been said to be a test more of exclusion
than of identification.”); State v. Scott, 33 S.W.3d
746, 756 (Tenn. 2000) (“Because it is not possible to achieve the extremely high level of exclusion provided by nuclear DNA, mtDNA typing has
been said to be a test more of exclusion than
one of identification.”).
17. Human Mitochondrial DNA — Amplification
and Sequencing Standard Reference Materials
1-2, National Institute of Standards and Technology, Pub. No. 260-155 (September 2003).
18. See Anderson, S., et al., “Sequence and
Organization of the Human Mitochondrial
Genome,” 290 n atur e 457-65 (1981).
19. There is a third highly variable region (HV3)
that has been studied, but it is not currently used
by forensic laboratories.
20. Holland, M.M., and T.J. Parsons, “Mitochondrial DNA Sequence Analysis: Validation and Use
for Forensic Casework,” 11 F or e ns ic s ci. r e v . 21,
24 (1999).
21. U.S. Department of Justice, “Mitochondrial
DNA Analysis at the FBI Laboratory,” F or e ns ic
s ci. c om m un . (July 1999).

DNA

INITIATIVE

CHAPTER 3

Discovery:­Getting­to­Know­a­Case­With­DNA­Evidence
Section­1:­From­Crime­Scene­to­
Laboratory
Crime­scene­collection
Depending on the type of case and the investigating body, documentary evidence regarding
the crime scene will be available to the defense,
such as:
■■

A written report.

■■

Photographs.

■■

Diagrams, including the location of evidence.

■■

A videotape.

Such documentation may reveal not only what
was collected but also what was not collected.
For example, an ashtray with cigarette butts in
it may provide DNA information: Were the cigarettes collected? Is there more than one brand of
cigarettes in the ashtray? Is there more than one
ashtray? What about the beer bottles? Is there
evidence that wasn’t collected that could have
provided additional DNA information?
Note: It is not the existence of DNA per se that
makes the collection important. It is the existence of a potential third party’s DNA that makes
collection important. This, of course, will be fact
specific and will not be a valid argument in every
case.
Pay attention to the cleanliness or dirtiness of a
crime scene. Are the ashtrays overflowing? Have
the dishes been washed lately? The DNA profile
found on a single coffee cup in an otherwise
clean kitchen sink is likely far more relevant than
a DNA profile found on a beer bottle in a house
with six dozen beer bottles strewn about the living room. Also consider potential transfer issues;

for example, if the victim was stabbed 100 times
and there is blood from floor to ceiling, blood on
the victim’s driver’s license on the dresser may
merely be due to circumstance and not particularly relevant.

Evidence­collection
Good resources providing an overview of evidence collection from a law enforcement perspective are the brochure, What Every Law
Enforcement Officer Should Know About DNA
Evidence (https://www.ncjrs.gov/pdffiles1/nij/
bc000614.pdf), and the online training courses,
What Every First Responding Officer Should
Know About DNA Evidence (https://letraining.dna.
gov, free registration required) and What Every
Investigator and Evidence Technician Should
Know About DNA Evidence (https://letraining.adv.
dna.gov, free registration required). The online
publication and training courses discuss various
collection protocols, although law enforcement
agencies typically have their own protocols for
evidence collection. Also, officers or forensic
technicians who collect crime scene evidence
may receive ongoing training, so collection protocols may change over time. All such information
should be gathered during discovery.
In general, evidence collection techniques that
minimize contamination include:
■■

Wearing gloves when collecting evidence and
using personal protective equipment (PPE),
such as booties and a face/particle mask, as
needed. In the crime scene environment, the
PPE works both ways — ensuring the safety
of the person collecting the samples and protecting the samples from contamination with
DNA from the collector.

■■

Changing gloves between sample collections,
or as needed, to avoid cross-contamination.

­2211

CHAPTER 3

■■

Ensuring that the area(s) used for evidence
collection and packaging of evidence are as
clean as possible.

■■

Inspecting the evidence collection materials
before their use to ensure that they are new
(unused) and clean.

■■

Ensuring that reusable implements such as
pens and clipboards have been cleaned/
decontaminated before starting any evidence
collection.

■■

Ensuring that reusable containers (e.g., bottles
with chemicals for blood screening tests) and
instruments (e.g., the alternate light source
and the trace materials recovery vacuum) have
been cleaned/decontaminated before starting
any evidence collection.

■■

Using disposable instruments for sample collection or cleaning collection instruments thoroughly before and after handling each sample.

■■

Avoiding touching the area on an item of evidence where it is probable that DNA exists.

■■

Avoiding talking, sneezing or coughing over
evidence.

■■

Avoiding touching the face, nose, mouth or
exposed skin when collecting evidence.

■■

When possible, ensuring that each piece of
evidence is dry (or will readily dry, such as
swabs put into swab boxes with airholes) and
in its own separate paper (not plastic) bag,
envelope or other appropriate container. When
it is not possible to completely dry evidence
before transporting, it can be temporarily
stored wet in a plastic bag or container; however, the item should be immediately removed
and dried according to agency protocol as
soon as possible.

■■

Sealing envelopes and bags with evidence
tape (not by licking them) or using envelopes
with self-adhesive backing. Staples should be
avoided because they may puncture the skin
and could lead to bleeding.

Compare the police department’s list of collected
items with the notes made at the crime lab that
document what was received by the crime lab.
Pay attention to the condition of items as they
are received at the lab. For example, if an item
arrives wet, the lab will document that condition.
If an item arrives with hair stuck in the tape sealing the envelope, the lab notes should reflect

­22

that. If a series of envelopes arrive at the lab with
red stains on the outside, this will also be documented. These types of notations could indicate
potential issues with collection procedures used
at the crime scene. Needless to say, laboratory
personnel cannot control contamination that
occurs at the crime scene or the conditions in
which the evidence is stored or transported
before arriving at the lab. However, they should
be aware of any potential issues with collection
and packaging that could affect the usefulness
of the evidence for subsequent examination and
reporting.

The­crime­scene
Crime scenes come in all shapes and sizes. A
temperature-controlled town home with the
blinds drawn may be the ideal crime scene,
affording officers the luxury of collecting evidence undisturbed. Outdoor crime scenes, such
as the middle of a cornfield in winter, the woods
or the desert, present challenges. Changes in
the weather, such as the onset of a storm, as
well as changes in lighting may limit law enforcement’s ability to observe and collect all relevant
evidence.
Once the crime scene is accessible, attorneys
should visit it and other relevant scenes whenever possible. Being at the crime scene(s) provides
additional information, possibly identifying other
evidence that could be or should have been
collected.

Chain­of­custody:­Proper­preservation­­
techniques­
A chain-of-custody record (either written or
electronic) that follows the evidence from crime
scene to courtroom should accompany the evidence. This record — which may also document
proper preservation techniques — is discoverable. The officer or forensic technician who collects the evidence documents where the item
was recovered and who put the evidence in the
container. The chain-of-custody documentation
should contain the names of everyone who had
custody of the evidence at any point, including:
■■

The person who collected the item of evidence and initiated the chain of custody.

DNA

INITIATIVE

DISCOVERY: GETTING TO KNOW A CASE WITH DNA EVIDENCE

■■

The person who brought the evidence to the
police department/crime lab.

■■

The person who logged it into the evidence
room.

■■

The person who logged it out of the evidence
room and brought it to the lab.

■■

The person who received it at the lab.

■■

The person(s) who received it from the lab
after final disposition.

Note: Each agency involved in the chain of custody may also keep separate chain-of-custody
documentation for each item of evidence.
These documents should also be requested and
reviewed to determine if there was a possible
break in the chain of custody or an indication of
inadvertent introduction of contamination.
Because chain-of-custody documentation will
reveal not only who had the items but also how
and where they were stored, a review should
consider both the chain of custody and the conditions under which the DNA evidence is collected and stored before it is submitted to the
lab and while it resides at the lab. DNA evidence
is vulnerable to deterioration when subjected to
sunlight, heat or humidity. Thus, evidence should
not be stored in the trunk of a police vehicle or
on the dashboard in hot weather. It is also reasonable to ask if the transporting vehicle had
air conditioning. If you are not familiar with the
notations used by an agency on chain-of-custody
documents, you may need to request additional
information to clarify the exact location and conditions under which an item of evidence was
stored.

List­of­evidence­items
Not all evidence collected by law enforcement
will necessarily go to the crime lab. Likewise,
not all evidence that goes to the crime lab will
be tested for DNA evidence. Depending on the
case, a lab analyst — alone (typically based on
the laboratory’s protocol) or with the assistance
of law enforcement, the prosecution or a lab
supervisor — will determine what items of evidence to test. Resources, potential probative
value of the evidence, and the law enforcement

DNA

INITIATIVE

or prosecution’s theory of the case are all factors
contributing to decisions about which evidence
to test. For example, certain types of DNA testing may not be performed on a particular item
if preliminary testing indicates that DNA testing
may not be successful.

Photographs­and­video
There should be photographs and/or video of
the crime scene. In addition to recorded images
taken by law enforcement and/or coroner/
medical examiner staff, there also may be local
news footage. Reviewing all of the images and
footage may provide reasons to collect additional
crime scene evidence.

Section­2:­Lab-Directed­Discovery
Defense counsel should be thorough when
requesting discovery and should make detailed
requests for files. Under most discovery rules,
defense counsel is entitled to (a) all information
regarding the prosecution’s efforts to make available the scientific test reports and relevant raw
data used in the case as well as (b) all information describing the prosecution’s efforts to maintain and preserve the evidence. The jurisdiction
should inform defense counsel if an evidentiary
sample will be or was entirely consumed during
the testing process. Therefore, in all cases in
which there is DNA evidence, defense counsel
should request the production of full discovery
and the preservation of all DNA evidence. If full
discovery is not provided or if evidence is not
preserved, defense counsel’s recourse is to seek
relief from the trial court, either through a motion
to compel discovery or through a motion to preclude the state from using the DNA evidence at
trial.
In response to a defense discovery request, the
prosecutor may initially provide a generic discovery response that is independent of the specific
case at issue. Followup discovery requests may
be necessary for the prosecutor to provide more
specific discovery materials. In addition to paper
and electronic discovery (discussed below),
defense counsel should ask to visit the laboratory at which the DNA tests were performed and
meet with the lab personnel who worked on the
case.

­
23

CHAPTER 3

A thorough review of a comprehensive discovery packet of the laboratory analyses may reveal
weaknesses in the chain of custody, scientific
procedure or analysis of the DNA data. Defense
counsel should learn the local protocols used in
the case and scrutinize the underlying data to see
if they support the conclusions drawn in the DNA
reports. Refer to Chapter 6 for in-depth information regarding data review and interpretation.

What­should­be­requested­from­the­lab?
1. A disk containing raw data, including but
not limited to the sample files, project files,
injection lists, sample sheets and injection
logs.
Start by reviewing the injection lists, sample
sheets and injection logs, noting the time and
date stamps on all runs to check the order in
which samples were run and to make sure that
controls were not substituted with those from a
different day. This could reveal a mistake or, in
the most extreme circumstance, indicate laboratory fraud; in either case, conclusions based on
the evidence and reference profiles would be
unreliable. If it was an honest mistake, the lab
should be able to provide data for the actual controls run on that day. If controls did not perform
properly or were not run, conclusions based on
the evidence and reference profiles would be
considered invalid. A laboratory that follows the
Quality Assurance Standards for Forensic DNA
Testing Laboratories (the QAS) — any laboratory
that uses CODIS (Combined DNA Index System)
— is prohibited from using any testing results
that are not supported by properly performing
controls (Standard 9.5, July 1, 2009).
Note: If the injection logs and sample sheets do
not match up, hire an expert to find out why. To
make sure you know what you are looking for,
you may want to hire an expert for at least one
case — or attend a training class that addresses
this topic.
Defense counsel should determine if the allele
calls of the evidence samples were made before
or after the reference samples were processed.
The lab’s protocol may be to run and call the
alleles on the evidence samples before knowing

­24

the profiles of the reference samples. This is particularly important for samples with complicated
mixtures, partial profiles or low peak heights, represented by low relative fluorescent unit (RFU)
values close to the analytical threshold. Context
bias may occur if the analyst knows the profiles
for the reference samples before interpreting the
profiles for the evidence samples.
The compact disk handed over during the discovery phase will also include electronic files
containing data on the DNA fragments separated
during capillary electrophoresis, which should
include the runs of positive and negative controls, reference samples and evidence samples.
The disk should also include the raw data before
they were processed for peak heights and allele
calls.
Graphs or electropherograms are generated that
are based on the analyst’s review and interpretation of the raw data. The reported DNA profile for
each sample is depicted on these graphs. Software programs for forensic STR DNA analysis
are in common use (e.g., Gene-Scan™ and Genotyper™ (which must be used in tandem), GeneMapper®, PowerTyper™, and TrueAllele®). The
laboratory’s protocol will specify which
program(s) have been validated and are being
used.
The criteria used to call alleles vary across laboratories. To analyze the raw data using different
criteria, counsel or a defense expert must be
able to operate the macros on the computer
using a computer program. Independent analysis
of the raw data may reveal potentially exculpatory peaks that might have been missed because
they were below the calling threshold used by
the laboratory. For example, the minimum peak
height that a lab considers might be 50 RFUs, but
there could be a true peak that is exculpatory at
45 RFUs. It takes only a one-allele difference in a
full single-source profile to exclude a suspect.
Note: Independent analysis of the data allows
the defense to look for data outside the threshold value(s) relied upon by the testing laboratory.
The disk will also include the electropherograms
— including all formats of loci data output — or
other images that have already been processed

DNA

INITIATIVE

DISCOVERY: GETTING TO KNOW A CASE WITH DNA EVIDENCE

by the laboratory to include alleles and peak
heights. These should be compared to the final
report to ensure that there were no transcription
errors. Also, look for signals that were dropped
from the reported profiles because they were
considered to be artifacts or noise.

determine whether consumption was indeed
necessary.

2. Copies of the DNA typing results.

There may be multiple forms or logs that comprise the chain-of-custody record. The defense
should determine that each item and sample was
accounted for at all times. Also check whether
any items were signed into two places at the
same time, which would indicate that the laboratory was not keeping track of the evidence
properly.

The electropherograms are frequently printed
out by laboratory analysts. These printouts may
be color copies, which are ideal, or they may be
black-and-white photocopies, which are somewhat harder to read. Regardless, the printouts
are often easier to view than the electronic files
because they do not require a computer or a
license to run the computer programs that generate the electropherograms. In fact, many DNA
analysts make allele determinations based on
the printouts, not the electronic files. Analysts
will often write notes on these printouts, such
as notations on peaks that were considered artifacts, descriptions of the baseline, and calculations of peak height ratios to distinguish stutter
from real allele peaks and distinguish heterozygous peaks from peaks of different contributors. These notes are also likely to be initialed by
the analyst making the calls. The defense should
consider whether an abundance of artifacts possibly indicates unreliable data or artifacts that are
masking true alleles. Defense counsel should
obtain copies of all printouts retained by the
laboratory.
3. Copies of real-time, slot blot or other
quantitation data.
Knowledge about the quantity of DNA obtained
is very important and is acquired using different
methods, the most common current method
being real-time PCR, also called qPCR. Each
quantitation method contains calculations for
estimating how much DNA was extracted from
each sample (some labs also determine how
much human male DNA is present). This information allows the defense to determine how much
human DNA was used and how much remains
from each sample, which could be retested. If
the DNA was consumed by the laboratory, knowing how much DNA there was originally can help

DNA

INITIATIVE

4. Case notes, including handwritten bench
notes, chain-of-custody record, and descriptions of the evidence.

The defense should investigate whether the reference samples were stored with the evidence
samples, which could create a vulnerability to
contamination in storage. The defense should
also determine whether the evidence examinations, DNA extractions, PCR setup and DNA
typing setup were conducted at separate times
or in separate spaces, as required by the lab’s
protocol, to ensure that the integrity of the evidence was preserved and that the DNA was not
vulnerable to contamination. For further discussion of DNA contamination issues, see Chapter
6, Section 2.
Normally, as indicated above, many items of
evidence are collected and only some of them
are tested. The items tested are usually chosen
according to the investigating agency’s or prosecution’s theory of the case. The defense should
consider its own theory and check to see if there
are other collected items that were not tested but
might support its theory, had they been tested
for DNA. The defense then might consider independent testing or an argument that failure of the
laboratory to test the items indicates a reason to
doubt the prosecution’s case.
5. Serology reports.
Because a positive serology report — a report
that indicates or identifies the presence of a body
fluid or biological material — provides context
for the DNA, it is important to determine if serologic tests were presumptive or confirmatory.
The most common serologic tests check for the
presence of human blood, semen and saliva. Presumptive tests reveal less information because

­
25

CHAPTER 3

it is not human specific, and there may be a
number of substances that result in a false positive result. For example, some presumptive tests
for blood may yield a positive result from rust or
some plant extracts.
In developing its theory, defense should consider
where physiological fluids should be expected or
not expected. The full serology report may help
bolster the defense theory or contradict the government’s theory. Although DNA may be identified on certain evidence samples, knowing what
type of biological material made the stain may
inform the defense’s theory of the case. Consider a case in which oral copulation with ejaculation is alleged and DNA on the lip area swab
matches the defendant. In the absence of serology results, DNA deposited from consensual
kissing could be misinterpreted as supporting the
state’s case. In such a case, serology testing can
confirm the presence of seminal fluid. Serologic
results could be critical to the defendant’s case if
semen was not found.
See Chapter 2, Section 2, for more on serology.
6. Correspondence between lab personnel
and any law enforcement, prosecutorial or
other state/county/jurisdictional officials.
It is important to look for sources of expectation bias, or a strong belief or mindset toward a
particular outcome. Often, lab personnel will be
given more information about the case than is
needed to conduct the forensic testing, and the
seriousness of the case could sway the scientist.
It is also possible that law enforcement inadvertently or directly states or hints to the forensic
analyst what the desired results should be.
Needless to say, this information might be developed as an area of cross-examination.
7. All documents routinely kept in the type of
case file referenced.
This request will ensure that the defense has all
of the other information from the laboratory case
file that was not already specifically requested.

­26

8. Documents related to the case that were
referenced regularly but are kept in a place
other than the case file.
This request will ensure that the defense has
reference material that is not included in the
specific case file but may have been consulted
in the case.
9. A copy of all documentation regarding
corrective action when casework errors are
detected pursuant to the QAS (July 1, 2009
revision), Standard 14.
All laboratories that follow the QAS — specifically, all laboratories that use CODIS and, typically, all laboratories accredited by ASCLD/LAB,
ASCLD/LAB-International, FQS or FQS-I — must
be in compliance with this standard. Disclosure
of any casework errors that occurred during a
reasonable period of time (e.g., 6 months), either
before or after the case-specific testing was
done, may open up areas of cross-examination.
See Chapter 5 for more information.
10. The quality assurance review (administrative and technical reviews).
Standard 12 of the QAS (July 1, 2009) requires
that a second qualified technician or supervisor review the reports, notes, data and other
documents and information related to the case
to ensure there is an appropriate and sufficient
technical basis for the scientific conclusions.
This is often referred to as a technical case file
review, conducted by the technical reviewer. All
case reports issued by a forensic DNA lab must
be subjected to both a technical review and an
administrative review. The administrative review
is conducted to ensure consistency with lab policies and editorial correctness and may be conducted by the technical reviewer.
Standard 12 also specifies that the technical
case file reviewer must be currently qualified, or recently tested for proficiency, in the
methodology(ies) used for technical reviews.
Any discrepancy between the initial analyst’s
and the quality assurance reviewer’s conclusions should be examined more closely to
determine if there is a basis for exclusion of the

DNA

INITIATIVE

DISCOVERY: GETTING TO KNOW A CASE WITH DNA EVIDENCE

DNA evidence or the presence of exculpatory
evidence. The defense may wish to call on both
the analyst who made the initial conclusions and
the technical reviewer (or, in rare instances, the
administrative reviewer, if different from the
technical reviewer) when a significant discrepancy involving the initial/reporting analyst’s report
conclusions departs significantly from laboratory
policies.
11. Data from the original case file if the case
is based on a convicted offender match, a
case-to-case match or a forensic match.
In a “cold hit” DNA match — and cases in which
the evidence is linked to DNA evidence in another case — complete copies of all files should be
obtained and reviewed for any discrepancies in
protocols, procedures and analyses, including
potential contamination issues. Be aware that if
the cases were examined at different times, the
laboratory may have used different laboratory
protocols that would explain the discrepancies.
12. Documentation stating that the laboratory
has searched for the casework DNA profile(s)
in its staff DNA database, including the
results of that search.
The defense should request documentation that
the DNA profiles of all laboratory employees,
especially those who worked on the case, have
been compared (typically via a database search)
against the casework profile(s) and what the
results of that search were. Defense should also
request documentation that the DNA profiles of
all crime scene investigators and law enforcement agents involved in the case have been
compared with the casework profile(s) and what
the results of that search were. This is particularly important in cases where the evidence
samples contain mixtures. It is a good practice
to provide a list as part of your discovery request
of lab employees, crime scene investigators and
case investigators that you want to ensure have
been compared with the casework profile(s).

DNA

INITIATIVE

13. Documentation from the three most
recent laboratory accreditation assessments/
audits, including DNA Quality Assurance
Standards audits and ongoing communications from the most recent assessment/audit.
As part of laboratory accreditation, the laboratory
undergoes both external and internal assessments (also called audits) against the accrediting
body’s defined criteria. The purpose of laboratory
accreditation is to have a systematic, independent and documented review of essentially all
aspects of a laboratory’s processes to objectively
evaluate them. By virtue of laboratory accreditation, labs seek to demonstrate that they are providing a quality product and that their customers
can rely on the results and reports issued by the
laboratory.
As part of the ongoing accreditation process,
regularly scheduled assessments/audits are
conducted to determine whether the required
accreditation criteria are being fulfilled and result
in the generation of documentation. In a manner of speaking, the accrediting body’s assessment/audit documents, the laboratory’s internal
assessment/audit documents and the DNA Quality Assurance Standards audit documents may
include criticisms of the laboratory. Each assessment or audit has the potential to result in proposed corrective actions or findings of identified
problems, to which the laboratory has time to
comply and fix (or appeal). Because remediation
of identified deficiencies can take some time, it
is important to ask for and review the communications/documentation related to the status of
open corrective actions/findings resulting from
the last assessment/audit.
Minor issues that do not affect the quality of the
product are identified all the time during laboratory assessments and are used to improve the
laboratory’s services and system. Of particular
importance are any findings or proposed corrective actions that are defined as ones that could
affect the quality of the results being issued by
the laboratory. For example, a finding or corrective action regarding a problem with the failure
of laboratory examiners to follow the defined
protocol for using a single strikethrough with
initials and date would not be considered to be

­
27

CHAPTER 3

a finding/proposed corrective action that affects
the quality of the testing results. On the other
hand, a proposed corrective action or finding that
multiple instances were found during review of
case files of reported conclusions deviating from
the laboratory’s defined interpretation guidelines
would be considered more significant — as this
could possibly affect the reliability and quality of
the lab’s reports.
Note: An accrediting body can receive information suggesting noncompliance of an accredited
laboratory with standards, either by the laboratory self-reporting or by the accrediting body
receiving a written allegation. If a complaint has
been received against a laboratory, the accrediting body will notify the laboratory. It is acceptable
to ask the laboratory, as part of discovery, for
information regarding any pending allegations
against the laboratory of serious negligence, misconduct or noncompliance that are being investigated by its accrediting body.

14. References to summaries of developmental validation studies for each of the DNA
testing methodologies used in the case, if
conducted by an organization other than the
DNA testing laboratory, and to summaries of
the laboratory’s internal validation studies
(and developmental studies, if applicable) of
DNA testing methodologies used in the case
and the supporting documentation.
In-house or internal validation studies provide the
defense attorney with knowledge of how the
laboratory determined the parameters for its protocols used to provide accurate and reliable DNA
profiles. Prior to using any forensic DNA procedures on casework samples, the methodologies
must be validated by the lab, and these studies
must be documented and summarized.
These validation studies provide the basis for
the interpretation guidelines and quality assurance parameters for the laboratory’s DNA unit,
including those for mixture studies. They can be
reviewed by an expert to assess the appropriateness and reliability of the laboratory procedures
to accurately determine DNA profiles from mixed
samples and define the range of detectable mixture ratios.

­28

Note: Copies of the validation summary reports
(both developmental and internal) can be provided easily; it is not burdensome to comply with
this request. Labs may be unwilling or unable to
create copies of the supporting documentation
for their internal validation studies because of the
labor required to produce such copious amounts
of paper. However, most labs should allow
defense counsel and the defense expert to visit
the lab to review such documentation.

15. Proficiency testing results of analysts,
technical reviewers and technicians in the
case.
Standard 13 of the QAS (version effective July
1, 2009) requires that all DNA analysts, technical reviewers and technicians must participate
in external proficiency testing twice per calendar
year. The results of proficiency examinations of
analysts, technicians and technical reviewers
who tested evidence or reviewed data in the
case may reveal problems, opening up potential
areas for cross-examination. Poor testing results
or deviation from the requirements as set forth in
the QAS may be a reason to try to preclude the
analyst from testifying at trial.
While it may be considered burdensome by a
laboratory to produce copies of all proficiency
testing records for the personnel involved in the
analysis/review of the case, the laboratory can
easily produce documentation that provides a
summary of the external proficiency testing history of each relevant DNA analyst, technician and
technical reviewer. Information on a proficiency
testing summary document should include:
■■

The external proficiency test identifier (including the name of the test provider as well as
the identifier for the test in question, e.g., CTS
#10-574, which refers to a proficiency test
sold by Collaborative Testing Services [CTS]
in 2010, with their designated test number of
“10-574”).

DNA

INITIATIVE

DISCOVERY: GETTING TO KNOW A CASE WITH DNA EVIDENCE

■■

The date the proficiency test was assigned to
the employee, received by the laboratory, or a
similar metric.

■■

The manufacturer’s due date.

■■

The date the proficiency test was completed
by the employee and/or the test results were
submitted to the manufacturer. To be counted
as an external proficiency test under the QAS,
this date must always be before the date the
manufacturer released the expected results of
the testing. Each manufacturer’s Web site will
contain information regarding the due date for
submission of results and the expected testing results (once released).

■■

A record of whether or not the proficiency test
was successfully completed and/or if any discrepancies between the employee’s answer
sheet and the manufacturer’s answer sheet
were noted. The laboratory may also indicate
on the summary if any corrective action was
required as a result of participation in the proficiency test.

The QAS provides very clear instructions regarding the acceptable length of time between participation in proficiency tests. Since July 2004, the
term semiannual, when applied to the DNA proficiency testing interval, has been interpreted as
an event that takes place two times during one
calendar year, with the first event taking place in
the first six months of that year and the second
event taking place in the second six months of
that year, with the interval between the two
events being at least four months but not more
than eight months. Any summaries of proficiency testing participation should be reviewed
to ensure that the analyst, technical reviewer
and technician’s testing results are in compliance
with this requirement. It is important to note that
the proficiency testing standards have evolved
over time, so you may need to put historical
entries in the context of the standard in effect at
the time the testing was conducted.

DNA

INITIATIVE

Note: Proficiency testing participation summaries can be provided easily by a laboratory for
each analyst, technician and technical reviewer;
it is not burdensome to comply with this request.
Many labs will be unwilling or unable to create
copies of the supporting documentation for the
proficiency tests these employees have participated in because of the extensive amount of
labor required to produce such copious amounts
of paper. However, most labs should allow
defense counsel and the defense expert to visit
the lab and review the relevant proficiency testing documentation in house. Should this opportunity arise, you will want to obtain a list of the
proficiency test providers used by the laboratory
ahead of time. Consult with or bring an expert
who can ensure that a thorough audit of the proficiency testing documentation is conducted by
comparing this with the summaries provided by
the laboratory, the QAS and the test results provided by the manufacturers.

16. Reference for, or a copy of, the documented population database(s) used to generate
the statistical interpretation of autosomal
(STR) loci testing results (commonly displayed as allele frequency tables) and a summary
or notation of what statistical method was
used; if applicable, a summary or notation of
the documented interpretation guidelines/
procedures for reporting of statistics for mixtures; and, if applicable, for analyses involving
nonautosomal testing, such as mitochondrial
or Y-STR DNA testing, a summary or notation
of the laboratory’s documented statistical
interpretation guidelines for such testing.
Allele frequency values (typically found in tables)
provide the basis for the statistics used to
describe the frequency of occurrence (rarity) of
the STR evidence profile in a given population.
A laboratory must use a documented population database(s) for which the calculated allele
frequencies are available for review (for the most
commonly used databases, see http://www.
cstl.nist.gov/strbase/population/PopSurvey.
htm#ReferenceListing).

­
29

CHAPTER 3

In addition, Standard 9.6.2 of the QAS (July 1,
2009) specifies which statistical formulae, as per
the recommendations of the National Research
Council (NRC) in its 1996 report titled The Evaluation of Forensic DNA Evidence, can be used by a
laboratory for autosomal STR statistical interpretations. A laboratory can deviate from the NRC
II recommendations if the court in its jurisdiction
has directed that a different method be used.
Because of this, the statistical formulae used
should be provided readily by the laboratory.

Case notes should be compared with laboratory protocols to ensure that there were no
deviations.

Of note is the fact that there can be genetic frequency variations within populations — for example, the frequency of occurrence of the THO1 9.3
allele is significantly different in samplings taken
from African-American and Caucasian-American
populations. This sort of variation is normal and
expected; however, it creates a topic to pursue
with the DNA analyst on cross-examination. The
analyst should be able to clearly describe what
segment of the population was sampled to create the database(s) relied upon by the laboratory
to conduct the statistical analysis. If the laboratory’s statistics are generated based on frequencies obtained by a convenience sampling of
convicted offenders, the analyst should be able
to explain why the sampling of STR markers in a
prison population does not deviate significantly
from a sampling of the same STR markers in
the general population and how they know this.
In addition, the analyst should be able to clearly
discuss why it is not necessary to generate statistics from a subsection of the world population
(to which the defendant can be assigned) to be
able to provide information to the jury regarding
the relative rarity of the evidence profile.

19. All reports for the case issued by the
laboratory.

17. Laboratory protocols used for all analytical procedures, including evidence-handling
procedures; serology/evidence screening
testing procedures; reagent preparation and
use methods; sample preparation methods;
extraction and quantitation methods; autosomal STR methods and/or other relevant
DNA testing methods; instrument calibration,
maintenance and operating methods; software operation methods; data analysis, interpretation and reporting methods; processes
for monitoring of analytical procedures using
controls and standards; and administrative
and technical review procedures for case files
and reports.

­30

18. The quality assurance program manual.
The defense should compare the case notes
with the quality control procedures outlined in
the quality assurance/system manual to ensure
that there were no deviations.

At the conclusion of testing, the laboratory
issues a report. In many jurisdictions, this report,
absent aggressive discovery requests from the
defense, is the first — and often the only — document provided by the prosecution. Beyond simply obtaining this report, it is important to ensure
that it has not been supplemented or modified/
amended over time. All reports (including preliminary, supplemental and amended reports, if
issued by the laboratory) should be obtained during discovery.
Note that Standard 11 of the QAS (July 1, 2009),
which deals with reports, specifies that the laboratory must retain sufficient documentation for
each technical analysis to:
■■

Support the conclusions in its report.

■■

Enable another qualified individual to evaluate
and interpret the data.

Accordingly, the materials requested under
items 1 through 5 in this section should contain
all of the case notes and analytical documentation related to the case and generated by the
analysts, as required by the laboratory’s written
procedures for taking and maintaining casework
notes that support the conclusions drawn in the
laboratory reports.
20. Any other information in the form of documentation, or encompassed in some other
manner, that the lab has in its possession or
control, or knows of and can access regarding
the case.
This particular request is designed to ensure that
there is no additional information that was not

DNA

INITIATIVE

DISCOVERY: GETTING TO KNOW A CASE WITH DNA EVIDENCE

specifically requested. The request to the lab
may not be worded this vaguely, but the attorney should be aware that, after initial discovery
is received, they may want to consult with their
own expert to determine whether additional
items should be requested.

Section­3:­Brady­and­DNA­Cases
The discovery obligation imposed on the prosecution includes the duty to preserve1 potentially
exculpatory evidence, and the separate duty to
disclose evidence or information that might be
exculpatory as to guilt or to punishment. Both
duties have constitutional foundations; both may
be made more rigorous by application of each
state’s constitutional protections, statutes or
rules of procedure.
The duty to disclose potentially exculpatory evidence is rooted in the guarantee of due process.
In Brady v. Maryland,2 the U.S. Supreme Court
held that “the suppression by the prosecution of
evidence favorable to an accused upon request
violates due process where the evidence is
material either to guilt or to punishment, irrespective of the good faith or bad faith of the
prosecution.”3 The requirement extends to the
disclosure of impeachment evidence4 and applies
regardless of whether the individual prosecutor
is aware of the evidence, as long as it is in the
possession of those acting on behalf of the prosecuting entity.5 Prosecutors have “a duty to learn
of any favorable evidence known to the others
acting on the government’s behalf in the case.”6
The list of evidence that might meet the Brady
standard in a case involving DNA evidence is
substantial and can include:
■■

Flaws in the collection process or chain of
custody.

■■

Lab-related evidence:
●■	

●■	

Prior incidents of laboratory error.
Failed proficiency tests by the lab technicians or analysts.7

●■	

Inconclusive results.

●■	

Evidence of contamination.

8

DNA	

INITIATIVE

■■

DNA evidence from other crimes that might
exonerate the accused in the case at hand.9

Unresolved at this time is whether the defendant
has a constitutional right to demand that DNA
profiles from a crime scene that do not match
the defendant’s profile be uploaded into and
checked against local or national databases to
potentially identify another suspect.10 Several
states allow such access by law.11

Endnotes
1. See § 32.04[3], infra.
2. 373 U.S. 83 (1963).
3. 373 U.S. at 87.
4. United States v. Bagley, 473 U.S. 667, 676
(U.S. 1985) (“Impeachment evidence, however,
as well as exculpatory evidence, falls within the
Brady rule.”).
5. Kyles v. Whitley, 514 U.S. 419, 437 (1995).
6. Ibid.
7. See, e.g., State v. Proctor, 348 S.C. 322, 332
(S.C. Ct. App. 2001) (holding that the defense is
entitled to proficiency tests under Brady).
8. In some factual settings, the inconclusive test
may not be exculpatory. See, e.g., People v.
Kazarinoff, 2004 Mich. App. LEXIS 3379 *15-16
(Mich. Ct. App. 2004).
9. See, e.g., People v. Rathbun, 2007 Cal. App.
Unpub. LEXIS 6877 (California Unpublished Opinions 2007) (explaining, “[a]ppellant’s theory is
that if DNA profiles similar to his were identified,
they could either indicate that a different party
committed the crimes, or cast doubt on the prosecution’s interpretation of the samples adduced
as [the] appellant’s,” but finding a failure to prove
that the prosecution had such evidence).
10. The argument in favor of such a requirement is that the cooperation between local
law enforcement (the agency prosecuting the
accused) and state and national law enforcement
authorities (the operators of DNA databases)

­
31

CHAPTER 3

brings them within the framework of Kyles v.
Whitley, supra, n. 6. For a discussion of when
the Brady disclosure obligation extends to law
enforcement agencies outside of the prosecuting
jurisdiction, see United States v. Risha, 445 F.3d
298 (3rd Cir. 2006).
11. 725 Ill. Comp. Stat. § 5/116 5 (2005) (allowing
such searches by court order); Ga. Code Ann.
§ 24-4-63 (2005) (providing similar access upon

­32

a showing that “access to the DNA data bank is
material to the investigation, preparation, or presentation of a defense at trial or in a motion for a
new trial”). Other statutes seem to permit such
access without specifically identifying criminal
defendants as those with rights to request such
searches. Haw. Rev. Stat. § 844D-82 (2006); N.C.
Gen. Stat. § 15A-266.8 (2005); Cal. Penal Code
§ 299.5(g)-(h) (West 2005); N.J. Stat. Ann. § 53:
1-20.21 (2006).

DNA

INITIATIVE

CHAPTER 4

DNA­Evidence:­Evaluation,­Assessment­and­Response
Section­1:­Evidence

Review­DNA­test­results­with­the­client­
early,­as­it­may­affect­the­case­resolution

Evaluate­the­context­of­DNA­results

Reviewing the DNA test results with the client
is crucial and should be done as early and as
thoroughly as possible. It is unlikely that a criminal defendant will have a working knowledge of
DNA and how DNA profiling works. Therefore,
discussions between lawyer and client serve
two purposes: (1) to determine if there is an
innocent explanation of how the DNA may have
been deposited on an item in question and (2)
to ensure that the client understands the significance of the DNA results. Counsel should be
prepared to talk to the client about the risks and
benefits of seeking additional testing, including
the capability of detecting touch DNA.

They’ve “got DNA.” What does this mean? A
variety of tests exist to detect the type of biological stain from which the DNA profile was
obtained. For example, sperm cells can be identified under a microscope; blood and saliva may
be detected through presumptive testing. (For a
more in-depth discussion on serology, see Chapter 2, Section 2.)

Determine­how­DNA­evidence­is­relevant
This seems like a basic question, but it warrants
some discussion. As a general rule, a date or
time stamp cannot be put on the deposition of a
sample from which a DNA profile was obtained.
Additionally, a DNA profile itself does not explain
the circumstances under which the DNA was
deposited at a specific location. Here are two
scenarios that explain how the presence of DNA
may be irrelevant to proving a case:
■■

If a woman says she was raped by her husband, and he says that the sexual contact was
voluntary, the fact that his semen is in her
vagina may not be significant.

■■

If a man’s DNA profile is found at the scene of
his wife’s murder, and the crime scene is the
man’s own home, the fact that his DNA was
found at the scene may not be significant. It is
expected that our DNA is in our homes, in our
cars, on our clothing and at our offices. DNA
can and does transfer.

It is not enough to tell the client over the phone
that there is a lab report finding his or her DNA
at the crime scene. This conversation must take
place in person. Take the time to talk about each
sample and where it was found and collected. A
cigarette butt found on the corner of Fourth and
Main may not be particularly damning.
There are times when defense counsel must
have a serious conversation with the client about
the strength of DNA test results. Competent
and effective defense counsel must educate the
client regarding the power and accuracy of the
DNA results. The client should be made aware
that — in the absence of an identical twin (with
autosomal STR analysis), contamination or a
highly unlikely coincidental match — the jury may
see the client as the source of the DNA evidence
and there may be no credible defense. One
straightforward way to explain this is to review
the underlying data in person, showing the client
a comparison, locus by locus, of the alleles found
on a particular piece of evidence to the alleles of
his or her DNA profile. This review can make this
clearer to the client. Defense counsel has an

­

33

CHAPTER 4

obligation to give the client the best advice.
Under certain circumstances, this may be to
encourage a plea.

trial. During the preparation, the expert should be
encouraged to identify any vulnerabilities or limitations. This is not the time to wing it.

Consult­with­someone­familiar­with­
forensic­DNA

Choose­the­right­kind­of­expert

Consulting is invaluable in DNA cases and can
assist counsel in understanding all of the issues,
including how to communicate in ways that
laypeople can understand. If a jury is unable to
understand an issue, it does not matter how
important that issue is. It is crucial to be able to
clearly communicate problems with the government’s interpretation of the evidence.

Hire­an­expert­(not­necessarily­to­testify)
An expert should be able to look at the evidence
and tell you what it means in easily understandable language. An expert may say that there is
no issue regarding the DNA evidence, that there
are issues but they are not relevant, or that there
are important and relevant issues. An expert may
serve solely as a consultant to assist counsel in
understanding the evidence and in preparing the
cross-examination of the government’s expert.
An expert may also be used to help explain the
significance of evidence to the client.
In addition to using a consulting expert, counsel
may wish to hire an expert to testify. Defense
counsel should first review the expert’s résumé
and prior testimony, and consult with experienced attorneys who are familiar with the
expert’s work and courtroom effectiveness.
Counsel should also investigate a prospective
expert’s background (e.g., see “Digging Up Dirt
on Experts” at www.ncstl.org). Public defender
offices, innocence project offices and criminal
defense attorney organizations are excellent
sources for referrals. Transcripts of expert testimony are available online to certified defense
attorneys through the National Association of
Criminal Defense Lawyers at www.nacdl.org.
Once the testifying expert has been vetted and
selected, counsel must prepare a very specific
list of questions and review them with the expert
before trial. Counsel should go over the direct
examination and anticipate cross-examination
questions with the expert at least once before

­34

Typically, the question in a DNA case is not “Do
I need an expert?” but rather “What kind of
expert do I need?” The answer lies in the specifics of the case. The first challenge is to locate an
expert to review the electronic data and paper
case file to determine whether there are issues
with the equipment, test kits, controls, testing
methods (e.g., longer-than-usual injection times),
interpretation of the results or statistics used. If
the statistics are questionable or flawed, a statistician or population geneticist is a much better
choice as a testifying expert than a lab analyst.
Conversely, if the injection time deviates from
the lab’s validated protocols, a lab scientist with
an understanding of the importance of following
protocols and the impact of an extended injection time will be a better choice.

Choose­an­expert­with­the­right­­
qualifications
Some take the position that only a person who
has worked in a crime laboratory is qualified to
testify about forensic DNA testing. Others assert
that crime lab experience is not necessary to
consult on a DNA case. All science is reproducible and verifiable, when done properly, regardless of the context of the testing.
The ability of your selected expert to properly
and thoroughly review the forensic biology case
files — both the paper and electronic data —
is critical. Complete review of a case file is a
tedious process that requires attention to detail
as well as the ability of the expert to consider
how the provided documentation fits into the
larger picture of the laboratory’s policy documents, its accreditation requirements, and the
Quality Assurance Standards for Forensic DNA
Testing Laboratories (the QAS, July 1, 2009).
Use of an expert who has worked in a crime laboratory may be valuable, provided the individual
has the requisite skills to conduct this type of
data and policy review.
When choosing a qualified expert for your
DNA case, consider those who have previously

DNA

INITIATIVE

DNA EVIDENCE: EVALUATION, ASSESSMENT AND RESPONSE

conducted evidence screening and DNA testing
on forensic samples and have testified in DNA
cases for the defense. For example, if the issue
is a statistical one, the head of the local university’s biostatistics department may make a fine
choice as an expert. The main considerations in
selecting an expert are to find someone who can
properly and completely review the case files
and who can also effectively communicate the
defense’s theory of the DNA evidence to the
judge or jury.
When choosing an expert, set up a meeting (teleconferencing or in person). Include a layperson
in the meeting who has no forensic DNA experience and can act as a test person. If the expert
can communicate the issues in a manner the test
person can understand, he or she will likewise be
able to explain the issues to a judge or jury.

serving as a witness; it is enough if the expert’s
assistance is needed to prepare defense counsel
for understanding and addressing the prosecution’s DNA evidence.5
Because DNA evidence has become more common and is likely to be admissible under either
Frye or Daubert standards, showing the need
for expert assistance may require disclosing
issues at the heart of the defense’s case theory.
Therefore, counsel should seek funding by ex
parte motion.6 In every case, defense counsel
will need to assess the strength of the DNA
evidence as well as possible noncriminal explanations for how the suspect’s DNA was found
at the scene. There are cases in which the need
for expert assistance may be particularly strong,
including:
■■

Cases with partial matches.

Section­2:­Funding­for­the­Defense­
DNA­Expert

■■

Cases where the results are reported as uninterpretable or inconclusive.

■■

Cases involving interpretation of mixtures.

Ake v.Oklahoma1 guarantees an indigent defendant reasonable funding for expert assistance:

■■

Cases involving defendants from population
subgroups that may affect the statistical significance of the DNA match.

■■

Cold cases, or cases where evidence collection or storage raises concerns of degradation
or contamination.

■■

Cases involving less frequently used, newer or
emerging forms of DNA analysis and statistical interpretation (such as Y-STRs, mtDNA,
mini-STRs, SNPs and low copy number DNA
testing [also called low-level or LCN testing]).

[W]hen a State brings its judicial power to
bear on an indigent defendant in a criminal
proceeding, it must take steps to assure that
the defendant has a fair opportunity to present his defense. This elementary principle,
grounded in significant part on the Fourteenth Amendment’s due process guarantee
of fundamental fairness, derives from the
belief that justice cannot be equal where,
simply as a result of his poverty, a defendant
is denied the opportunity to participate meaningfully in a judicial proceeding in which his
liberty is at stake.2
Although Ake involved access to funding for psychiatric assistance, its reach has been extended
to the forensic sciences, including DNA testing.3
The right to assistance is not absolute; rather,
it is case dependent and requires showing the
centrality or significance of DNA evidence to the
prosecution’s case: “[A] defendant must show
the trial court that there exists a reasonable
probability both that an expert would be of assistance to the defense and that denial of expert
assistance would result in a fundamentally unfair
trial.”4 The assistance need not be limited to

DNA

INITIATIVE

The motion seeking funds for DNA expert assistance should detail that: (1) forensic DNA evidence is central to the prosecution’s case and (2)
expert assistance is needed to determine any,
some or all of the following:
■■

The meaning and significance of the prosecution’s evidence.

■■

Whether retesting or testing other crime
scene evidence could be beneficial.

■■

Whether and how the prosecution’s evidence
is subject to attack.

■■

That the defendant is indigent and entitled to
assistance under Ake, and any applicable state
constitutional or criminal rule provision(s).

­
35

CHAPTER 4

The motion should also identify the cost of
expert assistance by listing each expert contacted, his or her hourly fee, and an estimate (by
each expert) of the cost of initial case review and
consultation. Leave should be sought for filing a
supplemental motion if, after consultation, additional expert assistance is necessary. In doing
so, be cautious about local practices in revealing
content of ex parte communications.
Note: A motion seeking funds to hire an expert
may reveal defense strategy. For this reason,
counsel should seek to file the request ex parte
and under seal. If there is any risk that the
motion will be disclosed to the jurisdiction’s
funding authorities or others, it should be a barebones pleading that can be supplemented at a
hearing before the court in camera.
It is critical that the motion and any supplements
— oral or written — be made part of the record.
If proceeding ex parte, the motion papers, any
transcript of an ex parte hearing, and the judge’s
order should be filed under seal. If the motion is
denied, counsel must take whatever steps are
necessary to ensure that the issue is preserved
for pretrial, interlocutory appeal, or appellate
review if the trial results in a conviction.

Section­3:­Evidence­Consumption
As an initial matter, labs are obligated, under
the QAS (July 1, 2009) Standard 7.2, to retain a
portion of the evidence for subsequent defense
testing: “Where possible, the laboratory shall
retain or return a portion of the evidence sample
or extract.”
It is important, however, to understand what
constitutes exhaustion of a sample. Based on
the guidance provided by the QAS, if a portion
of the DNA extract remains, even if the entire
initial evidence sample has been subjected to
the DNA extraction process, the sample has
not been consumed in analysis. An illustrative
example is the procedure commonly used for the
processing and extraction of DNA from cigarette
butts. When a lab conducts DNA testing on a
cigarette butt, it will typically opt (based on its
protocol) to “take the best evidence” for DNA
processing. Because of this, it is commonplace
for all of the outer paper from the anterior area

­36

of a smoked cigarette butt to be put through the
lab’s DNA extraction protocol. The end product
of the DNA extraction process is a DNA extract,
with the volume of this extract varying depending on a number of factors, including the laboratory’s protocol. Only a portion of the generated
DNA extract should be used to estimate the
quantity of human DNA present and to generate
the DNA typing result(s). Accordingly, a portion
of the DNA extract will remain — the volume of
which should be clearly discernible upon review
of the case file. The lab will preserve this remaining portion of the DNA extract in the manner
required by its protocol. This remaining DNA
extract is considered the portion of the initial
sample that remains for repeat testing, if necessary, or for possible subsequent testing on behalf
of the defendant. One potential exception to this
definition of evidence consumption is when a
laboratory defines exhaustion of a sample more
stringently in its protocol — if so, the laboratory
must adhere to its own definition.
There are times when the DNA testing process
will consume the entire sample. In this instance,
if required by the jurisdiction’s court or by laboratory protocol, the lab must notify either the
prosecuting authority or the relevant law enforcement agency before consuming the entire
sample. The case notes should clearly indicate
whether a sample was consumed in analysis
and, in some jurisdictions, the lab report will also
indicate this. In cases where there is no suspect,
some labs will proceed with testing without first
notifying anyone. In cases where there is a suspect (either charged or not yet charged), labs will
notify either the prosecuting authority or the relevant law enforcement agency before consuming
the sample. When dealing with an older case, it
is important to put the lab’s and forensic community’s practices into the proper historical perspective. As with a number of other current policies,
the requirement to retain or return a portion of
the evidence sample or extract has evolved over
time and was not always the required practice.
Defense counsel should be aware of notification requirements in consumption cases. For
example, some jurisdictions mandate that the
defense attorney or the public defender’s office
be notified before evidence consumption when
a suspect has not yet been charged. Other jurisdictions put the onus on the defense to request

DNA

INITIATIVE

DNA EVIDENCE: EVALUATION, ASSESSMENT AND RESPONSE

notification from the lab before any testing that
might consume evidence.
The basis for notification has to do with the
rights of the defendant. Because the evidence
will not be available for retesting, the defendant
is given the opportunity to ensure that the testing is performed in a reliable manner.
One option in cases where the evidence will be
consumed is for the defense and the prosecution
to agree on an independent lab (other than the
jurisdiction’s lab) at which to perform the testing.
An alternative may be to grant the defense the
right to have its expert observe the initial testing.
Neither option is ideal. Agreeing to a joint laboratory puts the defense in the position of endorsing
the results, which makes it more problematic to
challenge them if the results are not favorable to
the defendant. If the defense provides an expert
to observe the lab’s testing and no errors are
observed, the defense may have created an additional witness to vouch for the accuracy of the
lab’s test results. Counsel may wish to consider
a court order, before observing the testing, that
would prohibit the prosecutor or the prosecution’s witnesses from testifying to the presence
of a defense observer.
A different problem presents itself if the defense
observer sees a lab analyst mishandling a sample
or deviating from protocol. Most labs have rules
for what observers can and cannot do. For example, the laboratory policy may dictate where in
the lab nonemployees can go, or whether guests
must provide a known sample for comparison.
Court rulings should be obtained before testing to address what should be done if certain
situations arise during the testing process. For
example, should observers remain silent and
record their observations of deviations from protocol? Should observers object to the conduct?
Do observers have the power to prevent an analyst from proceeding a certain way? The answers
to such questions should be obtained before the
testing process.

Endnotes
1. 105 S. Ct. 1087 (U.S. 1985).
2. 105 S. Ct. at 1092.
3. See, e.g., Dubose v. State, 662 So. 2d 1189,
1199 (Ala. 1995); Polk v. State, 612 So. 2d 381
(Miss. 1992) (applying reasoning of Ake to hold
that due process considerations require defendant
to have access to a DNA expert); Polk v. State,
612 So. 2d 381: Superseded by Mississippi Transportation & Communication v. McLemore, 863
So. 2d 31, 2003 Miss. LEXIS 532 (Miss. 2003);
863 So. 2d 31, 39; Moore v. State, 889 A.2d 325,
336 (Md. 2005); Husske v. Commonwealth, 448
S.E.2d 331, 335 (Va. App. 1994), cert. denied, 487
U.S. 1210; Giannelli, Paul C., Husske v. Commonwealth, 448 S.E.2d 331: Opinion withdrawn by,
vacated by, different results reached on rehearing
at, en banc: Husske v. Commonwealth, 21 Va.
App. 91, 462 S.E.2d 120, 1995 Va. App. LEXIS 700
(1995); “Ake v. Oklahoma: The Right to Expert
Assistance in a Post-Daubert, Post-DNA World,”
89 C or ne ll l. r e v. 1305 (2004).
4. Moore v. State, 889 A.2d 325, 339 (Md. 2005).
5. Moore v. Kemp, 809 F.2d 702, 712 (11th Cir.
1987); Moore v. State, 889 A.2d 325, 339 (Md.
2005) (citing Kemp approvingly and collecting
cases adopting the Kemp formula).
6. See, e.g., Gianelli, “Ake v. Oklahoma: The
Right to Expert Assistance in a Post-Daubert,
Post-DNA World,” note 3; Shane, B., “Money
Talks: An Indigent Defendant’s Right to an Ex
Parte Hearing for Expert Funding,” 17 C ap .
D e fe ns e J. 347 (2005); Winbush, K.J., “Right of
Indigent Defendant in State Criminal Prosecution
to Ex Parte In Camera Hearing on Request for
State-Funded Expert Witness,” 83 a m . l. r e v .
5th 541 (2000). Nationally, courts are split as to
whether the defense is entitled to proceed ex
parte. See Moore v. State, 889 A.2d 325, 341
(Md. 2005) (collecting cases and approving of the
ex parte process).

Note: It is advisable that, at a minimum, the
defense attorney seek an independent expert
to review a laboratory’s case file when there is
a possibility that the evidence was consumed in
analysis.

DNA

INITIATIVE

­
37

CHAPTER 5

DNA­Basics:­Laboratory­Issues­
Section­1:­Standards­for­Labs,­
Personnel­and­Procedures
Getting to know the crime lab involves knowing
what types of documents and records exist and
what requests to make. One important document that provides a set of requirements is The
Quality Assurance Standards for Forensic DNA
Testing Laboratories (the QAS) (version effective July 1, 2009) (http://www.fbi.gov/about-us/
lab/codis/qas_testlabs). In addition to this set of
standards, the FBI also promulgates The Quality
Assurance Standards for DNA Databasing Laboratories (version effective July 1, 2009) (http://
www.fbi.gov/about-us/lab/codis/qas_databaselabs) for laboratories that process DNA databank
samples.
The QAS standards describe “the quality assurance requirements that laboratories performing
forensic DNA testing or utilizing the Combined
DNA Index System (CODIS) shall follow to
ensure the quality and integrity of the data generated by the laboratory.” Likewise, The Quality Assurance Standards for DNA Databasing
Laboratories describe “the quality assurance
requirements that laboratories performing DNA
testing on database, known, or casework reference samples for inclusion in the Combined DNA
Index System (CODIS) shall follow to ensure the
quality and integrity of the data generated by
the laboratory.” In the versions of these quality
assurance documents referenced before July 1,
2009, the QAS standards were guidelines; they
are now requirements.

DNA

INITIATIVE

Section­2:­QAS­Requirements­for­
Laboratories
A­quality­assurance­program
As can be noted from a review of the list of QAS
standards, DNA testing labs are required to have
a quality assurance program. Each lab is required
to document the details of its quality assurance
system in a manual that includes or references
the following elements: goals and objectives,
organization and management, personnel qualifications and training, facilities, evidence control,
validation, analytical procedures, equipment
calibration and maintenance, reports, review, proficiency testing, corrective action, audits, safety
and outsourcing (Standard 3.1.1).
Although you can rely on an expert hired to
review the DNA laboratory report and associated
documents, it is recommended that you be familiar with the basics of the lab’s quality assurance
system to ensure that any feedback received
from your expert is on target.

A­testimony­monitoring­program
The QAS standards (July 1, 2009) require labs
to “have and follow a program that documents
the annual monitoring of the testimony of each
analyst” (Standard 12.7). Testimony monitoring
is also a requirement of the accrediting bodies. Each lab can adopt whatever approach they
deem appropriate to ensure that each DNA

­

39

CHAPTER 5

analyst’s testimony is monitored annually. Examples of commonly used approaches are: monitoring by a lab supervisor, review of the testimony
transcript, or a customer survey-type process
that obtains feedback from customers such as
the prosecuting attorney, defense attorney
and/or judge.

The purpose of reviewing the summaries of the
lab’s validation studies is to assist you in ensuring that testing is done in a manner that is both
reliable and reproducible. The validation studies
can show the limitations of the system and when
the system is expected to work well. All of the
paperwork from the validation studies must be
kept at the laboratory and be available for review.

Organization­and­management­­
documentation

Based on the QAS standards of July 1, 2009, all
labs must perform a mixture study during their
internal validation before adding any new DNA
typing methodology for casework. The design of
a typical mixture study includes a 1-to-1 mixture
of DNA from two people. The test result should
show even peaks within the mixed profile — in
other words, if each individual contributing to the
mixture has two different alleles that are being
tested at one DNA location, four peaks should be
present that are of relatively the same height, or
intensity. A second portion of the study would
examine what the electropherograms would
look like, for example, in mixtures of DNA from
the same two people in ratios of 1-to-2, 1-to-5
and 1-to-10. Using the validation testing to show
what the varying ratios of DNA are expected to
look like is extremely valuable. Knowing at what
mixture ratio the results no longer appear as a
mixture is also helpful information.

In the QAS, Standard 4.1.5 addresses the organization and management of the laboratory.
This QAS standard requires labs to “specify and
document the responsibility, authority and interrelation of all personnel who manage, perform
or verify work affecting the validity of the DNA
analysis.”

Facilities­and­evidence­storage/control
The lab facilities’ setup requirements are found in
Standard 6.1, and the requirements for documentation of an evidence control system to ensure
the integrity of physical evidence are found in
Standard 7.1.

Section­3:­QAS­Requirements­for­
Laboratory­Procedures
Validation­studies
Standard 8 of the QAS addresses the details of
the requirements for validation, which involves
the extensive and rigorous evaluation of methods
and procedures before acceptance for routine
use in casework. The DNA lab can only use
methodologies that have been validated (Standard 8.1). As part of the validation process, the
procedures will have been tested both within
the normal limits of the method and at the outer
edge of the method’s capabilities. There are two
types of validations — developmental and internal. Developmental validation refers to the testing of new DNA testing systems that precede
the use of the novel methodology for forensic
DNA analysis. Internal validation refers to testing
done within the lab that has been reviewed and
approved by the technical leader before using the
methodology for forensic casework applications.

­40

Serology validation studies — where they exist
— can also be helpful. For example, if a lab has
recently put a new presumptive test for seminal
fluid online for casework, it will have conducted
an internal validation study. The validation study
summary should show what other fluids were
tested in addition to seminal fluid and should
specify if any other body fluids or materials tested positive with the presumptive test for seminal
fluid.

Analytical­procedures­and­equipment
Each lab must have and follow a set of analytical procedures (QAS Standard 9) that specifies
reagents, sample preparation, extraction methods, equipment and controls that are standard
for DNA analysis and data interpretation. In addition, the lab must have and follow written interpretation guidelines (Standard 9.6).

DNA

INITIATIVE

DNA BAsiCs: lABoRAToRy issuEs

QAS Standard 10 addresses the detailed requirements for equipment calibration and maintenance schedules. You will want to ensure that
the lab is following its documented program for
conducting performance checks and calibration
of its instruments and equipment as well as its
planned maintenance processes.
It is important to understand which lab equipment and instruments (such as pipettes and
thermal cyclers) have been deemed critical
— meaning that they require calibration or a
performance check before use and periodically
thereafter.

such that another qualified individual could evaluate and interpret the data.” Case files commonly
include:
■■

A chain of custody for items received by the
laboratory.

■■

Sketches or photographs taken in the laboratory of items examined.

■■

Examination (“bench”) notes by the analyst of
steps taken in testing.

■■

Laboratory logs or standard forms related to
testing.

■■

Electropherogram data (in older case files,
there may be strips, photographs and/or copies of autoradiographic film).

■■

Communication information between the
analyst and others involved in the case.

Writing­reports­and­reviewing­files
Detailed report-writing requirements are found
in QAS Standards 11.1 and 11.2. Standard 11.3
addresses the confidential nature of reports,
case files, DNA records and databank databases.
This standard requires that the lab must have and
follow written procedures to ensure the privacy
of the reports, case files, DNA records and databases. The lab must also have and follow written
procedures for the release of these documents
and information.
Standard 12 discusses the acceptable methods for reviewing case files and reports. Labs
are required to conduct and document both an
administrative and a technical review of all case
files and reports to ensure that the report conclusions are supported by the data and that the
conclusions — given the supporting documentation — are reasonable and within the constraints
of current scientific knowledge. The documentation of the report and case file reviews should be
included in the case file notes. Evaluation of this
documentation can assist counsel and experts in
determining whether, in the lab’s estimation, the
testing was performed correctly and within the
bounds of its procedural requirements.
In addition to the laboratory’s analytical report,
other documents related to a case must be maintained and reviewed. For example, QAS Standard
11.1 (July 1, 2009) requires laboratories to maintain a case file with “all analytical documentation
generated by analysts related to case analysis.
The laboratory shall retain, in hard or electronic
format, sufficient documentation for each technical analysis to support the report conclusions

DNA

INITIATIVE

Obtaining­transcripts­of­analysts’­­
past­testimony
Reviewing past testimony transcripts of laboratory analysts can be helpful. For example, a
scientist may have a particular way of explaining DNA transfer that he or she uses in every
case. Knowing what this explanation is ahead
of time can assist counsel in preparing crossexamination. Additionally, some scientists are
better than others in explaining DNA evidence.
There are several ways to obtain transcripts. If
analysts have testified in previous cases that
resulted in convictions, the appellate office of the
public defender is likely to have transcripts. Transcripts are also available through the National
Association of Criminal Defense Lawyers. If the
laboratory uses the review of transcripts to monitor personnel testimony, another option is to
request copies of past testimony transcripts in
the laboratory’s possession for the relevant DNA
analysts as part of discovery.

Outsourcing
The requirements for which laboratories can and
cannot be used for outsourcing of DNA testing,
as well as who can and cannot review the associated testing data, have also evolved over time.
Standard 17 clearly states that all vendor laboratories performing forensic DNA analysis must

­
41

CHAPTER 5

comply with the QAS as well as the accreditation
requirements of federal law. This is important to
keep in mind, should you wish to have testing
done on evidence that has not been tested by
the DNA lab in your jurisdiction, or if you want to
have retesting conducted.

Corrective­actions
Per Standard 14.1, “The laboratory shall establish
and follow a corrective action plan to address
when discrepancies are detected in proficiency
tests and casework analysis. … [D]ocumentation
of all corrective actions shall be maintained in
accordance with Standard 3.2.” In most accredited laboratories, a corrective action is documented by a CAR — a corrective action report.
It is noteworthy that although some labs keep
a central “corrective actions” file or logbook,
other labs simply document corrective actions
within the original case files. This information
is discoverable and can illustrate how easily
contamination can occur, even within a crime
lab. For labs that maintain the corrective actions
information within the specific case files, a court
order demanding that the information be culled
from the case files and compiled for discovery
purposes can be obtained.

Audits
As dictated by Standard 15, DNA labs are
required to conduct audits once a year to maintain compliance with the QAS. Per Standard
15.2, at least once every two years the laboratory must have an audit conducted by a team
comprising qualified auditors from an agency(ies)
other than its own. Standard 15.4 specifies that
both internal and external audits must be conducted using the FBI DNA Quality Assurance
Standards Audit Document (http://www.fbi.gov/
about-us/lab/codis/audit_testlabs).

­42

Section­4:­QAS­Requirements­for­
Laboratory­Personnel
Education,­training­and­experience
The QAS standards also cover educational, training and experience requirements for laboratory
personnel (Standard 5). These requirements
are clearly defined for the DNA technical leader
(Standard 5.2), casework CODIS administrator
(Standard 5.3), analysts (Standard 5.4) and technicians (Standard 5.5).

Proficiency­testing
The requirements for participation in DNA proficiency tests have evolved significantly over the
years. QAS Standard 13.1 (July 1, 2009) requires
each person involved with casework files —
analysts, technical reviewers, technicians, and
other personnel designated by the technical
leader — to undergo semiannual external proficiency testing in each technology performed
to the full extent in which they participate in
casework. In particular, addition of the technical
reviewer to the list of those required to complete
semiannual proficiency testing is new. Although
most labs were including the technical review as
part of the documentation for each proficiency
test, this requirement now formalizes that process, given that all casework files must be technically reviewed before the release of a report.
See Chapter 3 for recommendations regarding
requesting proficiency testing records as part of
discovery.

DNA

INITIATIVE

CHAPTER 6

DNA­Basics:­Understanding­and­Evaluating­Test­Results
Section­1:­With­Your­Expert’s­
Guidance,­Interview­the­Lab­Analyst
What­to­ask
Long before trial, defense counsel should meet
with the lab analyst — in person, whenever
possible — to discuss the DNA evidence. The
preferred location for the meeting is at the laboratory. The meeting may also take place at the
prosecutor’s office, the courthouse or possibly
the defense counsel’s office. It is a good idea to
bring a second person to the interview to listen
and take notes on a separate copy of the file.
Before the meeting, counsel should review a
complete copy of the lab’s file with an expert.
(For more information, see discussion on discovery in Chapter 3, Section 2.) The expert can
discuss the significance of each document and
alert counsel to any problems evident in the lab
file. (For more information about meeting with
experts, see Chapter 4, Section 1.)
When scheduling your meeting, ask the analyst
to bring the lab’s original copy of the case file to
the meeting.
At the beginning of the meeting, it is important
to confirm that you have all of the documents
the lab possesses. This can be done by simply
going through the stack of documents one page
at a time and visually confirming that each stack
has the same pages in the same order. This can
serve as a valuable ice breaker and ensures that
defense counsel has a complete copy of the file.
Next, go over the lab analyst’s curriculum vitae
in detail. If the analyst has published any relevant
articles, obtain copies and review them ahead
of time. Ask for defendants’ names and the
locations of any previous testimonies so you can

DNA

INITIATIVE

talk to the attorneys involved in those cases and
order transcripts.
Review each page of the lab file in chronological
order, starting from when the lab first received
the evidence. This may require you to put the
file in a different order than it was received during discovery — before your meeting with the
analyst — to save time. Make sure you have a
complete understanding of each document; do
not proceed until you understand the information
on each page and how that part of the analysis
fits into the overall testing process. Because you
have already reviewed the file with an expert,
repeating the process will allow you to determine
— well in advance of testimony — if the prosecution’s expert disagrees with your expert or interprets things slightly differently.
During the page-by-page review, counsel can
also incorporate questions critical to the defense
theory without specifically highlighting a particular theory. Before concluding the interview, ask
a close-out question such as, “Is there anything
else important we have not talked about?”
Note: The purpose of the interview is to obtain
information. It is not to argue the defense’s case,
give up defense theory, or divulge expert information that will assist the client. There may be
times when counsel wishes to raise a particular,
seemingly exculpatory subject with the lab analyst. However, before doing so, discuss possible
tactical and strategic ramifications with an expert
and your colleagues.
This meeting provides an opportunity to find out
the lab’s precise position on specific issues. It is
not in the client’s best interests to squander the
opportunity.

­43

CHAPTER 6

Section­2:­Interpretation­and­
Reporting­of­Results
Single-source­profile
Figure 10 shows an electropherogram of a
16-loci single-source sample. Generally speaking, a single-source DNA profile will have either
one or two peaks (alleles) at all of the areas (loci)
examined. If there are two peaks and the sample
is from a single source, they will generally be of
relatively equal height, or intensity. It is important to note that not all electropherograms will
have the loci printed above the peaks, as is seen
in Figures 10 and 11. (Figure 11 is an enlargement of the results at three loci.) Furthermore,
although it is most common to see electropherograms with boxes beneath each labeled
peak containing three bits of information — the
allele designation/call, the corresponding length
of the DNA fragment, and the relative fluorescence units (RFUs) for the peak — you may also
encounter electropherograms with only one or
two of these data points. You will need to
refer to the laboratory’s protocol to determine
what markings are required on the printed
electropherograms.
Assuming no identical twin, the probability of
two people — related or unrelated — sharing a
matching autosomal STR DNA profile at 13 or
more loci is highly unlikely. (For the statistical

­44

likelihood, see the discussion of random match
probability in Section 7 of this chapter.)
That said, what about the single-source sample
that does not include 13 loci? Each DNA profile
should be examined to determine (a) whether
there is a match and (b) whether that match is
with a complete or partial profile.
Note: The fewer loci that yield results, the greater the percentage of the population that can be
included as possible contributors.

Partial­DNA­profile
At times, a partial (incomplete) DNA profile will
be generated — that is, there will be no results,
partial results (e.g., only one of the two alleles
present at the locus has been labeled), or inconclusive data at one or more of the loci tested. It
is not uncommon for a partial (incomplete) profile
to be generated. This can happen for a number
of reasons, including the following:
■■

The sample size is very small.

■■

An insufficient amount of sample DNA was
used in the polymerase chain reaction (PCR).

■■

The original DNA sample has started to
degrade or break down, reducing the number
of intact DNA molecules.

DNA

INITIATIVE

DNA BAsiCs: EvAluATiNg TEsT REsulTs

Figure­10:­A­16-Loci­Single-Source­Sample

Source: Palm Beach County Sheriff’s Office.

Figure­11:­Enlargement­of­Results­at­Three­Loci,­Single-Source­Sample

Source: Palm Beach County Sheriff’s Office.

DNA

INITIATIVE

­
45

CHAPTER 6

■■

The sample contains a PCR inhibitor, such as
carpet glue or denim dye.

When looking at an electropherogram, the
smaller DNA fragments are located toward the
left side of the image, and the fragment sizes
get larger as you proceed from left to right. Thus,
referring to Figure 10, you’ll note that the loci listed on the left — D3S1358 (in blue), D5S818 (in
green) and amelogenin (in black) — are shorter
in length than the loci on the right — Penta E (in
blue), Penta D (in green) and FGA (in black). This
principle holds true for all electropherograms,
regardless of which testing kit is used.
The presence of a partial DNA profile is clear
when there are no labeled peaks under one of
the electropherogram loci labels. Because longer
pieces of DNA are more likely to be fragmented, or broken, during degradation of DNA and
because the PCR process can be less efficient
with longer pieces of DNA, you will be more
likely to see a partial DNA profile with the loci
results “missing” on the right side of the electropherogram. The presence of a partial DNA profile
is less obvious when only one of the alleles at a
locus is labeled.
The process of degradation occurs naturally
over time, particularly when DNA is subjected
to environmental factors such as sunlight, heat,
water and/or bacteria. The DNA molecule begins
to break down — not all at once, but gradually.
Accordingly, it is not uncommon to see partial DNA profiles when cold case samples are
examined. DNA degradation can also be seen in
“new” cases where a sample may have been
subjected to some sort of environmental insult
before the sample is recovered/collected (e.g.,
blood deposited in the closed trunk of a vehicle
that is subjected to direct sunlight during August
in Louisiana for a period of time before collection). Degradation often signals itself by a characteristic pattern sometimes referred to as the
“ski slope” effect. This ski slope pattern can be
clearly seen in Figure 12, where the peak heights
for the loci containing longer fragments of DNA
get progressively smaller, or lower.

When the lab report indicates that a partial DNA profile has been obtained, the DNA results should be
examined by your expert to determine the following:
■■

The correct alleles have been identified and
reported for the sample.

■■

There is actually a match.

■■

Whether the appropriate statistical formula
was used in interpretation of the match.

■■

Whether the interpretation of the match
follows the laboratory’s guidelines.

Mixtures
Figure 13 shows a 1:1 mixture and Figure 14
shows a 6:1 mixture. As can be seen in both
figures, it is clear that a mixture DNA profile has
been obtained (a) when more than two alleles/
peaks are observed at multiple loci and/or
(b) when there are only two alleles/peaks and
there is a significant difference in the height
of those peaks at multiple loci. The number of
called alleles at the loci can be used to determine
the most probable number of contributors to the
mixture profile result.
Often, a main concern with a mixture result is
whether or not the profile can be “resolved” to
determine the DNA profile of one or more of the
contributors. For example, in a mixture where 6
times more DNA is present from person #1 than
from person #2, it may be possible to determine
the alleles that would have been contributed to
the mixture from this “major contributor,” or person #1. Conversely, in the same 6:1 mixture, it is
typically not possible to discern with certainty all
of the alleles that would have been contributed
by the “minor contributor,” or person #2.

Figure­12:­Portion­of­Electropherogram­
Depicting­Degradation

Unlike degraded DNA — in which the larger loci
alleles tend to be lost first — in cases of inhibition that result in a partial DNA profile, random
alleles may be lost.
Source: Butler, Forensic DNA Typing, 2nd ed.

­46

DNA

INITIATIVE

DNA BAsiCs: EvAluATiNg TEsT REsulTs

Labs use varying approaches in interpreting
mixed samples. Historically, there has been a
lack of consensus in the forensic science community as to which is the best approach because
multiple approaches to mixture interpretation are
possible and appropriate.
Laboratories also vary in the manner in which
they conclude that a mixture is “resolvable.”
A resolvable DNA mixture is often identified as
a mixture of DNA from two people in which at
least one person can be definitively identified as
a contributor. To complicate matters further, in
samples where one of the contributors is known,
many labs will use their knowledge of this known
contributor’s alleles to resolve, or deconvolute,
the mixture.
With the release of the SWGDAM (Scientific
Working Group on DNA Analysis Methods) Interpretation Guidelines for Autosomal STR Typing
by Forensic DNA Testing Laboratories (henceforth, SWDAM Guidelines), approved on January
14, 2010 (online at http://www.fbi.gov/about-us/
lab/codis/swgdam.pdf), some guidance has been
provided regarding the way laboratories should
establish their guidelines for mixture interpretation. Labs are now strongly encouraged to have
the guidelines in place (listed in Table 1). The
intent is for each lab to clearly define how it is
interpreting mixtures. However, it is anticipated
that variations will continue to exist between labs
regarding how mixtures are interpreted.
Note: If a mixture result implicates a client, it is
strongly advised to consult with an expert to aid
in interpretation.
When a mixture contains the DNA of three or
more people — especially when all of the contributors are unknown and there is no clear major
contributor to the mixture — teasing it apart into
individual contributors is extremely challenging
and may be impossible. A degraded DNA sample
or varying concentrations of DNA can further
complicate interpretation of the mixture.
Note: If a complex mixture result implicates a
client, it is strongly advised to consult with an
expert to aid in interpretation.

DNA

INITIATIVE

Table­1:­SWGDAM­Guidelines­for­Mixture­
Interpretation­(January­14,­2010)
Guideline­

Summary­of­Guideline­Intent

3.5.1

Establishment of guidelines based
on peak height ratio (PHR) assessments to determine major and minor
contributors.

3.5.2

Defining and documenting assumptions made in mixture deconvolution.

3.5.3

Defining other quantitative characteristics, such as mixture ratios, to assist in
determining contributor profiles.

3.5.4

Establishment of guidelines for mixtures with a single major contributor
and one or more minor contributors.

3.5.5

Establishment of guidelines for mixtures with multiple major contributors
and one or more minor contributors.

3.5.6

Establishment of guidelines for
mixtures with indistinguishable
contributors.

3.5.7

Establishment of guidelines for determining whether separation of a known
contributor’s profile is applicable.

3.5.8

Establishment of guidelines for interpretation of potential stutter peaks in
a mixed sample.

Source: Scientific Working Group on DNA Analysis Methods
[SWGDAM] Interpretation Guidelines for Autosomal STR
Typing by Forensic DNA Testing Laboratories, issued January
14, 2010.

Contamination
To a certain extent, many items that are collected in connection with investigations contain
some amount of pre-existing (exogenous) DNA.
By definition, this pre-existing DNA is a contaminant. Accordingly, contamination can be said to
exist when a sample of interest is deposited on
an item that already contains DNA. In addition,
contamination can occur when a sample comes
into contact with an object that contains DNA
before its collection. Contamination can also
occur during the collection, examination or actual
DNA analysis of a sample — this is typically the
contamination of concern because it can be
avoided.

­
47

CHAPTER 6

Figure­13:­A­1:1­Mixture

Source: Palm Beach County Sheriff’s Office.

Figure­14:­A­6:1­Mixture

Source: Palm Beach County Sheriff’s Office.

­48

DNA

INITIATIVE

DNA BAsiCs: EvAluATiNg TEsT REsulTs

For example:
■■

If a bloody jacket comes into contact with a
hair brush during evidence collection at the
crime scene (or later) and blood gets on the
hair brush, contamination occurs.

■■

The profiles match, and the known individual
cannot be excluded or is included.

■■

The profiles do not match, and the known individual is excluded.

■■

The results are inconclusive or uninterpretable.
The results from multiple evidentiary items
are consistent or inconsistent with originating
from a common source.

■■

If a scientist sneezes directly on a sample or
open sample tube during testing, the sample
may be contaminated.

■■

■■

If a person collecting multiple items of evidence at the crime scene does not change
gloves between items, the samples can
become cross-contaminated.

■■

If the suspect’s known sample is opened and
processed before a crime scene sample on
the same laboratory bench, there is a risk that
the suspect’s sample will contaminate the
crime scene sample.

An inconclusive result is not the same as an
exclusion. Exclusion means that the profile could
not have originated from a source. An inconclusive result means that the forensic data does not
support an inclusion or an exclusion. Defense
attorneys are especially encouraged to examine
inconclusive test results to determine if there are
alternate explanations.

Some contamination sources are obvious,
whereas others may never be verifiable as
having occurred. An expert can assist counsel in
determining whether contamination could have
taken place.

Interpreting­the­data
As previously discussed, the Quality Assurance
Standards (QAS) for Forensic DNA Testing Laboratories specifically require labs to have general
guidelines for the interpretation of data, as do the
SWGDAM Guidelines (January 14, 2010). The
laboratory’s interpretation guidelines are based
on its internal validation data and its experience
with specific kits and instruments.
Based on the lab’s protocol, the lab determines
what alleles are callable for each sample; the
next step is for the analyst to directly compare
the evidence profile with the reference, or
known, sample profile(s). Guideline 3.6.1 of the
SWGDAM Guidelines states, “The laboratory
must establish guidelines to ensure that, to the
extent possible, DNA typing results from evidentiary samples are interpreted before comparison
with any known samples, other than those of
assumed contributors” [emphasis added].
The comparison of profiles will result in one of
the following possible conclusions:

DNA

INITIATIVE

If a person cannot be excluded on the basis of
this direct comparison of evidence with known
profiles, the next step is to perform a statistical
analysis in support of any inclusion determined
to be relevant in the context of the case. Specifically, Guideline 4.1 of the SWGDAM Guidelines
states, “The laboratory must perform statistical
analysis in support of any inclusion that is determined to be relevant in the context of the case,
irrespective of the number of alleles detected
and the quantitative value of the statistical analysis” [emphasis added].

The­source­—­a­single-source­sample­or­
major­contributor
What does source attribution, also referred to
as an identity statement, really mean? Some
labs feel comfortable reporting that a particular
individual was “the source” of a DNA profile
recovered from the crime scene. This conclusion
is very different from stating that the defendant
cannot be excluded as a possible source of the
DNA profile obtained from the item of evidence.
With source attribution, the lab is stating that this
evidence DNA profile originated from this particular individual.
Source attribution is based on use of a mathematical equation called the uniqueness formula.
Use of the uniqueness formula, to determine if
an identity statement can be made, was recommended by the DNA Advisory Board and in the
article, “Source Attribution of a Forensic DNA

­
49

CHAPTER 6

Profile,” published in Forensic Science Communications (available online at http://www.fbi.gov/
about-us/lab/forensic-science-communications/
fsc/july2000/source.htm).
The uniqueness formula requires that both the
size of the population being considered (typically,
either the U.S. population or the world population) and the confidence interval be specified.
The confidence interval essentially provides a
range of values around a measurement that conveys how precise the measurement is. Typically,
labs use confidence intervals of either 95% or
99%. To put this into perspective:
■■

When a confidence interval of 99% is used
to calculate the uniqueness of a profile in the
U.S. population of approximately 300 million,
the value obtained is roughly 30 billion.

■■

Following NRC II guidelines of the true match
probability being plus or minus 10-fold, the
obtained value is multiplied by 10 as a conservative estimate, which results in a calculated
value of approximately 300 billion.

■■

Based on the above uniqueness formula calculation, the generated random match probability
(RMP) calculation (see below) for the evidence
profile is compared with the uniqueness formula value. If the evidence profile frequency is
greater than 1 in 300 billion — or less than 2.9
× 10-11 — the lab will make the source attribution statement in their report.

■■

The source attribution can be stated as follows:
“We are 99% confident that, in a population
of 300 million unrelated individuals, the STR
DNA profile observed would occur only once
(i.e., it is unique).”
This statement is based on the knowledge
that the profile did occur once. Note that, without knowing whether it has actually occurred
or been observed, any particular 13-locus STR
DNA profile is unlikely to exist in a population
of 300 million.

In a lab report, if the lab is using source attribution, the conclusion statement will be similar to
the following:
[Suspect] (or his identical sibling) is the
source of the DNA profile obtained from
[item of evidence] to a reasonable degree of
scientific certainty.

­50

Because STR DNA technology cannot distinguish
between identical twins, they would be expected
to have the same DNA profile. Even if the other
twin has not been accounted for and may be
considered a suspect in the investigation or the
true perpetrator, note that the calculated RMP
values are still valid in relation to the probability
of randomly selecting an unrelated individual in
the population with the same DNA profile that
was obtained from the evidence sample.
Should you have a case in which the suspects
are related, be aware that the calculated RMP
values will typically underestimate the expected
frequency of the profile in related individuals.
If your client’s profile has been matched to the
evidence profile, and if your theory of the case is
that a relative of your client is the true source of
the evidence profile, all efforts should be made
to obtain a sample directly from this relative so
that the generated profile can be directly compared with the evidence profile. This precludes
the need to rely on a probability-based estimate
of a coincidental match. If the relative’s sample
is not obtained, relatedness calculations should
be requested if they are relevant and have not
been conducted yet. SWGDAM Guideline 5.2.3
addresses which calculations for relatedness
should be used.

Combined­probability­of­inclusion­­
or­exclusion­for­mixture­profiles
Combined probability of inclusion (CPI) and
combined probability of exclusion (CPE) calculations are commonly used by labs to indicate the
statistical significance of mixture results. CPI
is the percentage of the population that can be
included in a mixture profile; CPE is the percentage of the population that can be excluded from
a mixture profile. The CPI and CPE calculations
are closely related: CPI is calculated by multiplying the probabilities of inclusion from each locus,
and CPE is calculated by subtracting the value
obtained from the CPI calculation from 1 (i.e.,
1 − CPI). Likelihood ratio (LR) calculations are
also commonly used (see the next section). The
SWGDAM Guidelines do not state a preference
for using one statistical method over another.
However, labs are required to establish guidelines for selecting statistical formulas to be
used when multiple formulas are applicable
(SWGDAM Guideline 4.6.1) — in other words,

DNA

INITIATIVE

DNA BAsiCs: EvAluATiNg TEsT REsulTs

it must be clear which statistical calculations are
going to be used, and when.

Figure­15:­Restricted­vs.­Unrestricted­
Calculations

In mixture calculations, the concepts of “restricted” and “unrestricted” come into play. In a
restricted calculation, the relative peak heights at
each locus are taken into account when pairing
the alleles for the calculation. In an unrestricted
calculation, all of the possible combinations of
the alleles are deemed possible and are therefore used in the calculation. Figure 15, taken
from the current version of the SWGDAM Guidelines, illustrates this point. In the example depicted in Figure 15, it is assumed that two donors
and all peaks are above the stochastic threshold.
In a mixture profile with a distinguishable major
contributor profile(s), the major contributor(s)
may be suitable for statistical analysis, even in
the presence of inconclusive minor contributor
results. In general, with CPI/CPE calculations
(where there are no assumptions regarding the
number of contributors to the mixture), loci with
alleles below the stochastic threshold may not
be used for statistical purposes to support an
inclusion. Because of the potential for allelic
drop-out, there is a possibility of contributors
possessing alleles not represented among the
interpreted alleles, which is why those loci are
not used in the calculation. An exception to this
is the accepted application of a restricted CPI/
CPE to a profile with multiple major contributors,
despite the presence of minor contributor(s)
alleles below the stochastic threshold. SWGDAM
Guideline 5.3.5 describes how this calculation
would be conducted.
In a report, a CPI calculation looks something
like this:
The probability of a randomly selected,
unrelated individual having contributed DNA
to the mixture profile obtained from [evidence item] is approximately:
1 in 1.10 million for the U.S. Caucasian
population.
1 in 456,000 for the African-American
population.
1 in 525,000 for the southwestern
Hispanic population.

DNA

INITIATIVE

Source: Reproduced from SWGDAM Guidelines (January 14, 2010).

2.92 million for the general Asian 

population.
�
These calculations were conducted using
the combined loci in the Profiler Plus® and
COfiler® DNA typing kits.
In a report, a CPE calculation looks something
like this:
The probability of randomly selecting an individual from the African American population
that can be excluded as a contributor to this
mixture is greater than 99.999%.
The probability of randomly selecting an individual from the Caucasian-American population that can be excluded as a contributor to
this mixture is greater than 99.998%.
The probability of randomly selecting an individual from the southwestern U.S. Hispanic
population that can be excluded as a contributor to this mixture is greater than 99.999%.
This calculation was based on databases provided by the Federal Bureau of Investigation
and was conducted using the 15 STR loci in
the Identifiler® DNA typing kit.

­
51

CHAPTER 6

The most commonly used formulas for CPE/
CPI are listed in Guideline 5.3 in the SWGDAM
Guidelines (January 14, 2010). Examples of the
use of CPE/CPI calculations for mixture profiles
are also provided in Guideline 5.3.5.

4.73 quadrillion times more likely to have
originated from [suspect] and [victim/
complainant] than from an unknown individual in the U.S. Caucasian population and
[victim/complainant].
16.5 quintillion times more likely to have
originated from [suspect] and [victim/
complainant] than from an unknown individual in the African American population and
[victim/complainant].

Likelihood­ratios­for­mixture­profiles
Although LR calculations are typically associated with mixtures, they can also be conducted
on single-source evidence profiles. An LR is the
ratio of two probabilities of the same event under
different hypotheses. In forensic DNA testing,
the numerator typically contains the prosecutor’s hypothesis and the denominator contains
the defense’s hypothesis. This means that the
obtained ratio indicates how much more likely
the prosecution’s theory of the case is (the
defendant’s DNA is contained within the mixture
profile) compared with the defense’s theory of
the case (the defendant’s DNA is not contained
within the mixture profile). Note that the LR does
not take relatedness into account — it is used to
mathematically compare and contrast two possible theories for the evidence profile.
As with the previous types of calculations, LR
calculations can also be restricted when relative
peak heights are taken into consideration, or
unrestricted when the LR is calculated without
taking peak heights into consideration.
An LR calculation for mixtures is dependent on
three things: the evidence profile, the reference
profile(s) that have been compared, and the individual hypotheses. The lab has to “guess” the
defense hypothesis. This usually means setting
up the mathematical equation using two case
theories: Either the defendant’s DNA is in the
mix or it is not in the mix. Because there are
many testable hypotheses, most labs will select
the most commonly encountered hypothesis to
set up their LR calculations. This does not necessarily mean that they are opposed to or have
dismissed other potential hypotheses.
When stated in a report’s conclusion, the likelihood ratio looks something like this:
The DNA mixture profile obtained from [the
item of evidence] is:

­52

4.66 quadrillion times more likely to have
originated from [suspect] and [victim/complainant] than from an unknown individual in
the southwestern Hispanic population and
[victim/complainant].
12.0 quadrillion times more likely to have
originated from [suspect] and [victim/complainant] than from an unknown individual in
the southeastern U.S. Hispanic population
and [victim/complainant].
These statistics were generated using the
STR loci in the Identifiler® System. The statistics assume unrelated individuals.
The significance of the LR calculations may
generally be interpreted as follows:
■■

If the LR value is 1 to 10 times more likely,
there is limited support for the prosecution
hypothesis.

■■

If the LR value is 10 to 100 times more likely,
there is moderate support for the prosecution
hypothesis.

■■

If the LR value is 100 to 1,000 times more
likely, there is strong support for the prosecution hypothesis.

■■

If the LR value is 1,000 or more times more
likely, there is very strong support for the
prosecution hypothesis.

Commonly used LR formulas are listed in
SWGDAM Guideline 5.4.2 (January 14, 2010).
Examples of the use of restricted and unrestricted LR calculations for mixture profiles are also
provided in SWGDAM Guideline 5.4.2.

DNA

INITIATIVE

DNA BAsiCs: EvAluATiNg TEsT REsulTs

Expectation­bias
Expectation bias — having a strong belief or
mindset toward a particular outcome — is a phenomenon that has been studied and published
in the literature. For example, knowing the allele
types of a potential contributor before analyzing the evidence may influence how the analyst
interprets the evidence sample. All scientists
should agree that expectation bias exists, but
they will have differing opinions as to its relevance in forensic analysis. Expectation bias
may be particularly relevant in mixture cases.1

Section­3:­Technical­Artifacts­and­
Interpretation­of­Results
Artifacts are peaks or other abnormalities on the
electropherogram that are not attributable to
the DNA actually present on the evidence item.
Artifacts can result from a non-allelic product that
is generated during the amplification process,
they can be associated with anomalies in the
detection process, or they can be a by-product of
primer synthesis. Technical artifacts have been
documented and are routinely observed; laboratories are required to use protocols to distinguish
between artifacts and real DNA peaks. An independent expert may disagree with a lab’s conclusion that a peak is an artifact; instead, the expert
may conclude that the peak accurately represents relevant DNA evidence or, conversely, that
a peak that is called an allele by the lab is not a
true allele.
The most common artifacts are stutter, spikes,
nontemplated nucleotide addition, dye blobs,
shoulders/split peaks, drop-out, drop-in, pull-up,
and raised baseline/noise (or background).

Stutter
Stutter is a minor peak that is typically observed
that is one repeat unit smaller than a primary
STR allele and is believed to result from strand
slippage during the DNA amplification process.
Stutter is expected when STR PCR technology is
used.

DNA

INITIATIVE

Here is how stutter occurs, according to the
slipped-strand mispairing model: Recall that
when the double-stranded DNA is heated up, the
strands are separated into two halves to allow
new DNA to be synthesized, after the temperature is changed to allow the DNA primers to
adhere, or pair, to their corresponding areas on
the DNA molecule, and after the temperature
is modified again to favor extension of the DNA
template strands. During the synthesis process,
most of the bases re-pair as expected (As bond
with Ts, and Gs bond with Cs), creating two
paired strands of DNA where there was once
one strand. Stutter occurs when, after the strand
is heated and separated and the primers have
been attached to the strands of DNA that are
being copied (i.e., the template strands), one of
the strands “breathes” or “bulges out” during
the DNA extension process so that it is not lying
down in a straight line, as is usually observed.
This unpairing during the DNA extension process
allows slippage of either the original template
strand (forward slippage) or the strand that is
being extended from the primer (reverse or backward slippage). The end result is that a shortened
PCR product is created that is one less repeat
unit shorter in length than the primary (real) STR
allele.
Take, for example, a strand of DNA that has eight
four-base-pair repeats. If the template strand
bulges during the time the bases are being added
to copy the DNA strand, the bases will continue
to bond down the line, skipping the bulge. This
results in a strand that has eight repeats on one
side of the strand (with one four-base-pair repeat
bulging away from the straight line) and, on the
other side, only seven repeats. When the strand
is heated again and breaks apart, there are eight
repeats on one half and only seven repeats on
the other half. This seven four-base-pair repeat is
now in the reaction tube and behaves just as the
rest of the strands during new DNA synthesis.
Thus, the seven-repeat copy (which was created because of strand slippage) continues to be
copied along with the strands that contain eight
repeats (the “true” original number of copies
of the repeat unit of the template DNA put into
the analysis tube). The seven-repeat copy will
appear on the electropherogram as a minor peak.

­
53

CHAPTER 6

Whereas Figure 16 demonstrates what normally
occurs during the polymerase chain reaction
(PCR) process, Figure 17 depicts how stutter
occurs according to the slipped-strand mispairing
model.
Why might this become a problem? In a casework mixed sample, the number and identity
of the contributors can never truly be known —
there is almost always the possibility of a small
amount of pre-existing DNA being present before
deposition of the biological sample of interest.
Given this, a low-abundance, seven-repeat fourbase-pair product could be due to stutter created during the PCR testing process or to low
levels of a seven-repeat fragment of DNA from
a second contributor. There is often no way
to know for sure, particularly when a complex
DNA mixture is encountered that contains DNA
from three or more people. The laboratory has
guidelines — based on its established stutter
percentage expectations (sometimes referred
to as stutter cut-off values), its evaluation of
peak height ratios (PHR), and its set analytical
threshold based on signal-to-noise considerations
— to help determine whether a peak should be

declared a true allele and whether it is indistinguishable from stutter.
The quantitative threshold for declaring a putative DNA peak as potential stutter is based on
how single-source DNA samples behave in the
lab during validation studies. The stutter percentage expectations for a laboratory are generated
by quantifying the percentage of stutter product
peaks during the review of single-source samples
during validation. Using this method of evaluation, the percentage of stutter product formation
seen for each allele at a locus is generated by
dividing the observed stutter peak height by the
corresponding allele peak height over multiple
runs. Understand, however, that just because an
allele meets the mathematical criteria for being
“stutter,” it is not necessarily stutter; it could be
the original DNA from the deposited biological
material.
For example, by taking a look at the dilution studies done by the lab during its mixture validation
studies (where two known samples of differing amounts are combined and then subjected
to PCR), it is possible to see the presence of

Figure­16:­Illustration­of­Normal­Copying­of­Template­Strand­During­PCR

PCR = polymerase chain reaction.
�
Source: Christine Funk, Working Group Member.
�

­54

DNA

INITIATIVE

DNA BAsiCs: EvAluATiNg TEsT REsulTs

Figure­17:­How­Stutter­Occurs

Source: Christine Funk, Working Group Member.

DNA

INITIATIVE

­
55

C H A P T E R 6
�

Random­match/man­probability­(RMP)­for­a­single-source­sample­or­major­contributor
Many labs do not use the source attribution terminology. instead, they report the result as an inclusion or a nonexclusion along
with an RMP or other appropriate frequency estimate. RMP is the probability of randomly selecting an unrelated person from
the population who could be a potential contributor to the evidence profile. Another way to think about the RMP is that the
calculated number is the theoretical “chance” that, if you sample one person at random from the population, they will have the
same DNA profile as the one obtained from the evidence sample.
it is important to be aware of what an RMP does not mean. in Forensic DNA Typing (2nd edition), Dr. John Butler provides some
clear examples of what a RMP is not:
■■

RMP is not the chance that someone else is guilty.

■■

RMP is not the chance that someone else left the biological material at the crime scene.

■■

RMP is not the chance of the defendant not being guilty.

■■

RMP is not the chance that someone else, in reality, would have that same DNA profile.

RMP calculations must be conducted using DNA results obtained from evidence items — not from known sample profiles. in
addition, the lab should never use inconclusive or uninterpretable data in the RMP statistical analysis or any other statistical
analysis. The lab should not calculate a “composite” statistic by attempting to multiply RMP values obtained at some loci with
another type of statistic (lR or CPE/CPi) calculated at other loci. The lab can, however, calculate RMP for the major contributor
to a mixture profile and can also conduct another type of calculation (lR or CPE/CPi) on the entire mixture profile.
RMP values are typically associated with single-source DNA profiles, but they can be calculated for mixture samples as well.
When applied to mixtures, this calculation is referred to as a modified RMP, which includes an assumption of the number of
contributors to the mixture.
RMP values for single-source samples and for a single major contributor to a mixture are calculated using the formulas
described in NRC ii recommendations 4.1, 4.2, 4.3 and 4.4. Because the laboratory must document the population database and
the statistical formulas used, that information should be easy to find in the laboratory’s manual or in the case file. The most
commonly used formulas are listed in SWGDAM guideline 5.2. Examples of the use of RMP calculations for mixture profiles are
provided in SWGDAM guideline 5.2.2 as well.
use of an RMP statistic in a report will be similar to the following:
The approximate frequency of the DNA profile obtained from [item of evidence] is:
1 in 3.3 sextillion in the Caucasian-American population.
1 in 75 sextillion in the African-American population.
1 in 38 quintillion in the Hispanic-American population.
1 in 22 septillion in the Asian-American population.
These statistics were generated using the 15 sTR loci in the PowerPlex® 16 system. These statistics assume
unrelated individuals.

­56

DNA

INITIATIVE

DNA BAsiCs: EvAluATiNg TEsT REsulTs

known donor alleles that now mathematically
meet the stutter criteria as well as stutter alleles
that mathematically meet the criteria for true
alleles. The latter is seen particularly when the
minor peak appears between two real alleles
(i.e., a minor peak of 11 repeats that is present
when major, true peaks are present at 10 and
12, and either the donors are of relatively equal
intensity or the donor of the 12 allele is the major
contributor to the mixture). Although this is not
the primary goal of the mixture dilution study, it
illustrates how small amounts of DNA can sometimes be indistinguishable from stutter.
The SWGDAM Guidelines (January 14, 2010)
provide guidance for labs on the interpretation of
potential stutter peaks in a mixed sample (Guideline 3.5.8). Specifically, Guideline 3.5.8 states
that labs are expected to determine whether
minor peaks in the stutter position are an actual
stutter peak, an allelic peak, or indistinguishable
as an allelic or stutter peak. Although this determination is based primarily on the height of the
peak in the stutter position, and its relationship to
the stutter percentage expectations established
by the laboratory, the SWGDAM Guidelines
clarify what the general expectations are and
acknowledge that there will be some exceptions.
The key is that the laboratory should declare
what the minor peaks in the stutter position are
— a stutter peak, an allelic peak, or indistinguishable — before any comparisons are made with
any known samples, other than those of the
assumed contributors.
Note: Stutter is another reason why a defense
expert should evaluate the electronic data and
electropherograms, particularly in mixture cases.

Spikes
Spikes are straight and narrow peaks, typically
seen in relatively equal intensity, in all color channels on an electropherogram (see Figure 18).
Spikes are generally due to alternating-current
voltage fluctuations but can also be observed
because of air bubbles or crystals of urea that
cross the detector. Spikes are not reproducible
from one run to another. Accordingly, when a

DNA

INITIATIVE

spike is suspected, the sample is typically rerun
because a spike does not normally appear in the
same position twice.
It is important to be aware of spikes so that you
understand why an analyst may disregard what
appears to be a peak and why a sample may be
rerun.

Dye­blobs
Dye blobs are artifacts made up of excess dye
(see Figure 19). They can occur in any sample
when dye, unattached to any DNA, comes
through the capillary and passes over the laser
light, which records the blob as an allele.
Dye blobs have physical characteristics —
tending to be broad and often irregular in shape,
with low RFU values, and corresponding to the
spectrum of one of the dyes contained within the
DNA typing kit. Dye blobs tend to appear in the
same general location on the electropherogram,
which makes them readily identifiable. However,
when dye blobs have not been or cannot be
removed, they may obscure true peaks or other
relevant data, which can affect interpretation.

Drop-out
With low quantities of DNA or with degraded
DNA, allelic drop-out can occur (see Figure 20).
Drop-out occurs when alleles from a DNA
profile “drop out” of the electropherogram
because of a small quantity of an allele going
undetected or an allele failing to amplify during
PCR. This may involve one or both alleles at a
particular locus. Typically, drop-out occurs at the
larger loci first (the ones on the right-hand side of
the electropherogram).
Note: Although drop-out is a documented phenomenon, it does not normally occur in robust
samples and should not be used as a defense in
these situations. An assertion of drop-out should
be supported by objective criteria. In these situations, the defense is strongly encouraged to hire
an expert to review the data.

­
57

CHAPTER 6

Where drop-out is a legitimate possibility, the
lawyer should be aware that it is theoretically
possible that any allele could have dropped out
at the locus. Other combinations of alleles not
present in the reference sample could also be
a possibility. For example, if the defendant is a
6,7 at THO1, the evidence profile shows only a 6
allele, and the scientist believes there was allelic
drop-out, the scientist may still consider an inclusion based on the rest of the profile. Typically,
the associated statistical calculation will reflect
the value (or lack thereof) of this determination
by the examiner. However, the lawyer should
understand that other alleles could have dropped
out and that other combinations of alleles (e.g.,
6,6, 6,7, 6,8, 6,9, 6,9.3 and 6,10) could exist in
the sample.
Care should be taken when pursuing the possibility of allele drop-out if the results are consistent
with the following: (a) the presence of a single
contributor, (b) the locus/loci where allelic dropout occurred have higher molecular weights (are
located on the right side of the electropherogram), (c) empirical data suggest that degradation
was probable, and (d) the statistical calculation
still strongly supports that the sample originated
from your client.

Drop-in
Drop-in occurs when alleles not originating from
the actual sample appear on the electropherogram. The source of allelic drop-in is often
undetermined but may be due to low-level contamination in the laboratory that is introduced
into the sample, sample container or reagents.
Some labs using robotic systems have ongoing
difficulties with allelic drop-in. Drop-in alleles
are typically not reproducible on subsequent
reanalysis. Accordingly, if the sample size allows,

­58

the lab may opt to retype and/or re-amplify the
sample.

Shoulders­and­split­peaks
A shoulder (also called minus A) is a common
artifact (see Figure 21). After the amplification
process and during an incubation period, an additional adenine (A) base is added to the amplified
DNA by the Taq polymerase used in the PCR
process. This additional A base is expected to be
on each amplified piece of DNA and is included
in the sizing of each DNA fragment in the allelic
ladder. If too much of the sample DNA is added
to the tube or well, there may not be enough
time (or adenine bases) to add the extra base to
each allele. Thus, a shoulder peak will be seen,
which will be one base pair smaller/shorter than
the actual allele. Shoulder peaks can also be
seen if the PCR conditions are not optimized. In
instances where the amount of sample injected
onto the capillary is so great that it overwhelms
the detection system, a split peak may occur
(see Figure 22). The resulting peak ends up being
fairly broad; it may appear that there are two
peaks when there is only one. When samples
are overloaded, the genotyping software cannot properly assign an accurate peak height to
the off-scale data. These peaks are assigned an
artificial height value that does not represent the
true intensity of the peak. Therefore, peak height
values for off-scale data should not be used in
peak height ratio and stutter peak assessments.
These split peaks are often called +A/−A artifacts
because they may be one base pair larger or
smaller than the true allele size used for comparisons. When split peaks are observed, the
remedy is to retype the sample (or re-amplify it,
in some cases, when too much template has
possibly caused the problem).

DNA

INITIATIVE

DNA BAsiCs: EvAluATiNg TEsT REsulTs

Figure­18:­Spike­Artifacts

Source: Palm Beach County Sheriff’s Office.

Figure­19:­Dye­Blob­Artifacts

Source: Palm Beach County Sheriff’s Office.

DNA

INITIATIVE

­
59

CHAPTER 6

Figure­20:­Drop-out­Artifacts

Source: Palm Beach County Sheriff’s Office.

­60

DNA

INITIATIVE

DNA BAsiCs: EvAluATiNg TEsT REsulTs

Pull-up
Pull-up, also called bleed-through or incomplete
spectral separation, occurs when the software
cannot properly resolve the dye colors used to
label the DNA fragments when the electropherogram is created from the raw data (see Figure
23). This is usually due to high concentrations
of DNA in the sample; this can complicate data
interpretation in complex mixture samples. When
pull-up happens, a peak corresponding to the
length of one that actually exists in one color
may appear to be recorded as a minor peak in
one or more other colors. (When the dye colors
are laid on top of each other, one can see the
“peak-beneath-a-peak” phenomenon clearly.)
These additional peaks are not actual DNA; however, they may look like DNA if they happen to
line up where a true allele might be. Conversely,
in a mixture with a minor contributor, pull-up may
mask a true allele.

Figure­21:­Shoulder­Artifacts
Shoulder — -A artifacts, partial adenylation,
where some of the PCR products do not contain
the extra A

Source: Palm Beach County Sheriff’s Office.

Figure­22:­A­Split­Peak­Artifact

Peak­height­imbalance
Peaks are expected to be “balanced” within
a locus (the same genetic marker) (see Figure
24). For example, if the DNA came from a single
source and that individual is a 14,16 at a particular locus, the peaks should be of relatively
equal intensity and the same height, and their
measured RFU values should be approximately
the same. However, there are certain conditions
known to cause peak height imbalance, such as
degradation, inhibition, low template DNA and
mixtures. Although not typically considered to
be an artifact, peak height imbalance can cause
difficulty in data interpretation and is therefore
mentioned here.
In the instance of a mutation that has occurred
in or close to the area on a person’s DNA where
one of the primers binds (called a primer bindingsite mutation), an actual peak height imbalance
artifact can be observed. These individuals will
exhibit more of one of their alleles at the affected
locus than the other. This is not a problem when
the same kit is used to type all of the samples
that are compared; indeed, the imbalance
between the two alleles at the locus is
reproducible.

Split peak—mix of both +A
and -A artifacts; may occur with
oversaturation due to high
amounts of template DNA
(sample overloading)

Source: Palm Beach County Sheriff’s Office.

Figure­23:­Pull-up­Artifacts

Pull-up—is due to spectral
overlap, resulting in a peak
of one dye spectrum present
in another, commonly seen
with saturated peaks (sample
overloading)

Source: Palm Beach County Sheriff’s Office.

DNA

INITIATIVE

­61

CHAPTER 6

In some instances, a primer binding-site mutation may actually result in one of the alleles not
being observed when one DNA kit is used versus
another (i.e., D8S1179 typing results are 14,15
using one kit and 14,14 using another kit). The
loss of an allele in this instance is a function of
the primer used by one company corresponding
to an area where there is a mutation, and the
primer used by the other company falling inside
the area where the mutation occurs, thus avoiding it. This lack of concordance between DNA
typing kits has been documented a number of
times and is the primary reason why the CODIS
searching algorithm allows for one mismatch, or
wobble, position (i.e., when searching using 13
loci, 22 out of 26 allele calls must match, rather
than 26 out of 26.
Consult with the defense’s expert to determine
what significance, if any, peak height imbalance
may have in a case.

Elevated­baseline­or­background­noise
Noise is a natural by-product of the instrumentation and is always present on the electropherogram. It appears as a horizontal “squiggly” line
(baseline) at the bottom of each color and can
be seen when one has “zoomed in” on the
baseline. Noise can be a problem (a) when the
sample size is physically small, (b) the amount of
the sample amplified contains less than the optimal amount of template DNA, or (c) the sample
contains a mixture of DNA with one or more
minor contributors. In these instances, if the

Figure­24:­Peak­Height­Imbalance

noise becomes too high, it can result in a labeled
“peak” that is close to the analytical threshold,
which can be misinterpreted as an allele. Conversely, an allele may be misinterpreted as noise.
Each lab uses their validation data to set the analytical threshold. In some instances, the set analytical threshold is for all capillary electrophoresis
instruments the lab owns; in other instances,
analytical thresholds can vary for different instruments. The analytical threshold is based on
signal-to-noise considerations, which allow
the lab to distinguish potential allelic peaks
from background noise in most instances.
The SWGDAM Guidelines make it clear that
the lab’s analytical threshold cannot be established for purposes of avoiding artifact labeling
because that would result in the potential loss
of allelic data (Guideline 3.1.1.2).

Section­4:­What­the­DNA­Results­­
Do­Not­Show
Transfer
Although a defendant’s DNA profile may be present in a sample, the testing itself cannot determine how or when it got there. For example,
if the defendant’s clothing was gathered and
stored in the same bag as the victim’s bloody
clothing, it is possible that the victim’s DNA
transferred onto the defendant’s clothing when
it was collected — and not when the crime was
committed.

Contamination
It is often difficult to determine whether a profile
or part of a profile is due to the presence of contaminating DNA. Evidence may be contaminated:

Source: Palm Beach County Sheriff’s Office.

­62

■■

Before the crime was committed (commingling of items).

■■

During the crime.

■■

During evidence collection. If the contamination is due to the addition of the collector’s
DNA, this will often be detected, particularly
when the lab has a staff database.

DNA

INITIATIVE

DNA BAsiCs: EvAluATiNg TEsT REsulTs

■■

During improper storage of the evidence.

Defendant­is­the­DNA­source

■■

During laboratory testing.

First, counsel may want to accept that the defendant is the source of the DNA. In some cases,
the defense will be that the defendant was
involved in the act with which he is charged, but
his involvement was legally justified. Examples
include consent and self-defense. In these cases,
the existence of the defendant’s DNA would be
expected, and the DNA match actually corroborates the defense theory.

Consent
DNA may identify the presence of an individual
but not the circumstances under which the DNA
was deposited. DNA deposited consensually
looks exactly like DNA left without consent.

When
A DNA profile can confirm an individual’s presence, but it cannot tell when the DNA was left in
a given spot. For example, DNA found on a soda
can at a crime scene may have been deposited
at the time of the crime or at some earlier point.

The defense may also argue that although the
defendant is the source of the DNA, he was not
involved in the act with which he is charged.
Instead, his DNA became involved through
another means, such as transfer, prior contact,
laboratory contamination, prosecution or law
enforcement malfeasance, or the possibility that
another individual planted the defendant’s DNA.

Why
There may be a logical explanation for how an
individual’s DNA was deposited on an item at the
crime scene. For example, the defendant’s blood
may be found on the victim because the victim
attacked the defendant and a fight ensued.

Section­5:­Alternate­Theories­of­
Defense
A DNA match between a defendant and an
evidence sample does not mean that the prosecution’s version of events is the only possible
explanation for the DNA evidence. There are a
number of possible defense theories. By understanding what DNA evidence is — and is not —
the defense attorney can evaluate its impact on
the defense theory.
Defense counsel must think critically about how
to explain the DNA results to jurors so that they
think about DNA from the defense’s perspective.
Counsel should consider how the DNA evidence
is significant to the charges, how it relates to
other evidence, and whether there is an innocent
explanation for its presence.

DNA

INITIATIVE

Defendant­is­not­the­DNA­source
Alternatively, when dealing with a partial DNA
profile or a mixture DNA profile, the defense
may be best served by arguing that the defendant is not the source of the DNA or a contributor to the mixture profile. The defense may argue
that the match or inclusion is coincidental —
particularly when paired with an argument that
the government is inflating the match’s statistical
significance. For example, from the defense perspective, the lab analyst’s use of a modified RMP
in a mixture case would inflate the statistical significance of the match as compared with another
method like the CPI. (See Section 2 in this chapter for a discussion of statistical calculations.)
The defense may claim that the report of a
match or inclusion was false because of the
analyst’s subjective interpretations of low-level
DNA. Counsel may also argue that a mixture
demonstrates the existence of a third-party perpetrator or that there are reasons to exclude the
defendant as a contributor to the sample. In such
cases, the defense can actually use the DNA evidence to contradict the government’s theory.
When arguing that the defendant is not the
source of the DNA, it is important to ensure that

­
63

CHAPTER 6

no other significant evidence links the defendant
to the scene. The defense argument that the
DNA did not come from the defendant is most
effective when there is:
■■

No eyewitness identifying the defendant (or
there is an eyewitness who positively identifies someone else).

■■

No other inculpatory forensic evidence.

■■

No confession from the defendant.

■■

Additional evidence of a third-party perpetrator.

■■

Alibi or character evidence for the defendant.

The defense can also use serology to supplement DNA. Serology testing can help determine
what kind of stain (blood, semen or saliva) was
present. Counsel should investigate whether the
type of sample can be used to corroborate the
defense theory or dispute the prosecution’s theory about what occurred. If the laboratory does
not routinely perform certain body-fluid screening
tests, you may be able to use this to your advantage by establishing, on cross-examination, that
the analyst has no idea from which type of biological material the DNA profile was obtained.

Section­6:­DNA­and­the­Client
Defense attorneys must have conversations with
clients to explain and discuss what DNA evidence means, any avenues for challenging it, the
difficulties in challenging DNA evidence, and how
the client can help in the defense.
These conversations can be difficult, but developing an early working relationship with the
client will enable counsel to have substantive
conversations about what DNA evidence may or
may not show.
When first informing a client that evidence from
the crime scene appears to match his or her
DNA profile, consider having a discussion along
the following lines:
The lab results indicate that DNA found at
the crime scene matches your DNA. With
this evidence, it is going to be difficult to convince a jury that you were not at the crime
scene. We have to really reconsider whether
sticking with a misidentification defense (or

­64

other defense that does not address the
DNA results) is the best strategy. Let’s talk
about your options in light of this evidence.
A client — invested in having his attorney believe
his innocence — may continue to insist that the
lab results are wrong. To address this, counsel
can discuss the possibility — or improbability —
of finding an expert to dispute the results and
then focus on how a jury will be likely to view the
DNA evidence.
The client may also want to have the evidence
retested — or have the testing conducted on
evidence that has not yet been tested. Counsel
must explain the risks of retesting/testing (discussed in more detail in Chapter 3, Section 1),
which include triggering the prosecution to test
first, alerting the prosecution that the defense is
testing, and having to turn the results over to the
prosecution. The client must understand that a
retest or newly requested testing can bear negative consequences if a result comes back that
includes him/her as the main DNA contributor.
As discussed earlier, the more counsel can avoid
talking about the DNA results as being indicative of the client’s guilt, the more successful the
defense will be in having frank, substantive conversations about the risks and rewards of retesting and new testing of the DNA sample.
Defense attorneys must also counsel clients on
the issues surrounding DNA databases. First, the
defense must inform the client if the offense he
is currently accused of (arrest or conviction) may
lead to his DNA being put into a DNA databank.
You may also need to explain that his prior arrest
or conviction in another incident may have resulted in his DNA profile already being in a DNA
databank. Explain what a DNA databank is and
what will happen with the DNA in the future —
in particular, that future evidence samples from
crime scenes will be checked against his and
others’ DNA profiles to see if there is a match. If
counsel can challenge or petition for the removal
of the client’s inclusion in the databank — in
some jurisdictions, after an acquittal — be sure
to inform the client of his rights and provide help
or a referral to get his DNA out of the databank.
In addition, be certain to petition for removal of
the evidence profile in addition to any arrestee
sample that may exist. If the laboratory maintains
suspect DNA profiles at either the local (LDIS)

DNA

INITIATIVE

DNA BAsiCs: EvAluATiNg TEsT REsulTs

level or the state level of CODIS, or if the lab
maintains a database separate from CODIS that
contains profiles, be certain that the petition
includes removal of the profile from those databanks/databases as well.

when determining a statistical frequency of the
observed STR profile in court cases. See the section on use of the product rule, (page 68).

Section­7:­Types­of­Statistics­—­
What­Do­They­Mean?

In addition to declaring a DNA match, inclusion
or failure to exclude, lab reports must provide a
statistical frequency that will give weight to the
match.

Where­do­these­numbers­come­from?
Frequency values used in statistical calculations
come from databases. Some labs have their own
databases, and some labs rely on work conducted by the FBI or other labs for their databases.

What­is­in­the­database?
DNA profiles. Typically, a lab has collected DNA
samples and generated profiles from a minimum
of 100–150 people from each of three or four
population groups for inclusion in a portion of
the database. Each person has two alleles at
each locus; with 100 people, there would be 200
potential alleles in the database at each locus;
with 150 people, there would be 300 potential
alleles at each locus. These DNA profiles are
examined, looking for their frequency of occurrence in the sampled portions of the population.
For example, if the 16 allele is observed, at the
genetic marker D3, 15 times out of the 150 profiles (300 total possible alleles) in the database,
5% of the 16 allele is observed (15/300 = 0.05).
Thus, the lab assigns the frequency of 5% to
the 16 allele (in the frequency chart, this would
appear as 0.05).
This is done for each allele at each locus. Based
on work done in the field of statistics, it has been
determined that a minimum sampling of this size
— about 100 — can be used to infer the frequency of occurrence of each of these alleles in the
entire population. Given that the STR loci comply
with certain rules of population genetics (HardyWeinberg equilibrium and linkage equilibrium are
discussed later in this chapter), these frequencies can then readily be extrapolated to the entire
population. These basic calculations are relied on

DNA

INITIATIVE

RMP­and­source­attribution­statements

An example of a typical RMP statement was
provided in Section 2 of this chapter. Be advised
that some labs, rather than give a statistical calculation in their report, may instead use language
that declares the profile is unique within the
U.S. or world’s population, or declares that an
individual is the source of the DNA. This is called
source attribution. Each lab has its own protocols
for report wording. They are discoverable and will
typically be found in the lab’s procedure manual
and/or its quality assurance manual.

Hardy-Weinberg­expectations/equilibrium­
(HWE)
How are these random match/man probability
statistics calculated? For that matter, what is
the basis for any of the calculations? A similar
mathematical approach, using defined formulas,
is used for all DNA profile statistical calculations,
regardless of whether the profile is a singlesource profile, a partial profile, or a mixture profile. Allelic frequencies from databases that have
demonstrated adherence to Hardy-Weinberg
expectations/equilibrium (and no linkage) are
used to calculate genotypic frequencies of each
STR locus result. These genotypic frequencies
are then multiplied together, using the product
rule, to generate an estimated frequency of
occurrence of the obtained DNA profile in the
population to which the database corresponds.
Take, as an example, a person who has the heterozygous profile of 14,16 at the genetic marker
D3. The corresponding values for the frequency
of occurrence of those alleles can be obtained
from the database frequency tables. To obtain
the frequency of a person in the population having a 14,16 profile at D3, the frequency of having

­
65

CHAPTER 6

a 14 allele (as determined by the aforementioned
database) is multiplied by the frequency of the 16
allele, and this number is then multiplied by two.
Why two? Because of something called
Hardy-Weinberg equilibrium, or Hardy-Weinberg
expectations:
1 = p 2 + 2pq + q 2
where:
�
p 2 = frequency of AA genotype 

(homozygote)
�
2pq = frequency of Aa genotype 

(heterozygote)
�
q 2 = frequency of aa genotype 

homozygote).
�
It is important to note that HWE is applicable
because we are talking about genetic markers —
a system that follows Mendelian genetics. What
is key is that during formation of gamete cells
(egg and sperm), the markers segregate in pairs
and sort themselves independently, which allows
shuffling of genetic information for each gamete
that is formed. In other words, the human population is considered a Mendelian population — it
is a group of interbreeding individuals who share
a common set of genes and genetic markers,
called the gene pool.

with people who are visually similar to them
or have the same belief system they have.
3. The population must be free from outside
evolutionary forces such as mutation, migration and natural selection. Migration occurs
constantly within the human population, as do
mutations to our DNA, and natural selection
occurs, naturally over time — meaning that if
a particular DNA sequence of a gene brings
some benefit to the population, this genotype
will be favored during mating or proliferation
of the species over time.
Why, in the face of such an apparently blatant
mismatch between the concepts of HWE and
the human population, is HWE applied to the
assessment and application of statistics generally
accepted within the scientific, population genetics, forensic biology, and mathematics communities? To shed some light on this question, each
of these concerns, outlined above, is addressed:
■■

That the population must be infinitely
large: In reality, for the purpose of generating
statistics relative to casework genotypes, the
population can easily be defined as infinitely
large. Why is this, if we know that the U.S.
and the world populations are finite in size? A
minimum group size of 100–150 people has
been repeatedly shown to be of sufficient
size to demonstrate that HWE applies to the
human population for STR loci, regardless of
the geographic area sampled. What these
population samplings show is that after testing a few hundred individuals, allele frequencies essentially “plateau” after about 200 data
points. Accordingly, more extensive sampling
of the population is not necessary or of any
benefit.

■■

That the population must be randomly
mating: There is nothing about someone’s
STR typing results that would have an effect
on the choice of a mate in a population. Random mating implies that any individual of one
sex is equally likely to mate with any individual
of the opposite sex in the population. While
geographic location, socioeconomic status or
background, race, and physical characteristics
such as body type, height and weight can and
do influence the choice of mate, STR typing
results are “invisible” to us and, therefore,
the expectation of random mating applies to

Using the D3 profile example and the laws of
HWE:
(frequency of 14,14 typing result)2 +
2(frequency of 14 allele) × frequency
of 16 allele [representing frequency
of 14,16 typing result] + (frequency of
16,16 typing result)2 = 1, over time.
What are the concerns about applying HWE to
the calculation of statistics that assign levels of
significance to casework DNA profiles that are
generated? There are plenty of concerns. The
laws of HWE require the following:
1. The population being tested is infinitely large.
Clearly, the U.S. and the world populations do
not meet this criterion.
2. There is random mating. This is not the case
for humans, in general, because people tend
to mate within their own geographic area, and

­66

DNA

INITIATIVE

DNA BAsiCs: EvAluATiNg TEsT REsulTs

them. Often an analyst will not be able to successfully explain to a jury why STR loci can be
considered to meet the HWE of random mating, so cross-examination on this point can be
effective.
■■

That the population is free from mutation,
migration and natural selection: Although
the human population is clearly not free from
these evolutionary forces, there is nothing
about one STR allele that favors it over another.
All of the STR loci do not code for proteins, as
far as is currently known — human characteristics favored by mutation, migration and natural
selection all code for proteins, the structure
of which can and does lend an evolutionary
advantage in some situations. Applying statistics to DNA typing results, the fact that the
population frequency values of the samples
continue to meet Hardy-Weinberg expectations
supports the view that the human population
is sufficiently free of these evolutionary forces
to allow use of the frequency values that have
been established.
This can be the most difficult of the HWE
concepts for an analyst to explain to a jury.
Mutations of human DNA have resulted in
variations of our population at each STR locus
over time. This approach can be effective during cross-examination.

There are some departures from Hardy-Weinberg
expectations that have been noted and are worth
exploring further in some cases, for example,
the observed inbreeding and kinship factors. The
effects of these factors are the result of mating
between closely related individuals. This results
in an increase in the number of homozygotes
and the decrease of heterozygotes compared
with the general or randomly sampled population. Along these lines, a population subgroup’s
homozygosity can increase at a locus and concurrently decrease in heterozygosity. Population
subgroups are considered to be small population groups (such as the Amish) that seek to
mate solely within their own groups. Genetically
speaking, this is similar to inbreeding, but it does
not result in narrowing of genotypes to the same
degree. Of note is that each of these population
subgroups will demonstrate common ancestry
through typing of different genetic markers. Of
importance is that statisticians can measure the
existence of population substructure that occurs
in these groups with a value called a theta (ϴ)

DNA

INITIATIVE

correction — colloquially referred to as the
inbreeding coefficient. The greater the theta
value, the greater the corresponding substructure.

Homozygote­“correction”­factor
DNA labs use a correction factor, of sorts, in an
effort to address concerns about the underestimation of homozygotes due to substructuring
that has been documented in the population.
NCR 11 recommends that the following formula
be used to determine the frequency of occurrence of homozygous genotypes:
1 = p 2 + p(1 – p)ϴ
where:
p = frequency of allele in the database,
ϴ = 0.01 for most populations, and
ϴ = 0.03 for small native populations.
Most DNA labs use a theta value (ϴ) of 0.01 for
most, if not all, of their calculations. This theta
value, in conjunction with the modified formula
for determining the frequency of a homozygous
genotype, boosts the frequency estimate of
homozygotes. This results in a more conservative value in the event that substructure is found
to be a factor. Population geneticists argue that
such an overestimation of frequency will always
favor the defendant. Conditional subpopulation
calculations may also be performed in accordance with NRC II formulas 4.10a and 4.10b, as
per SWGDAM Guideline 5.2.1.4.
No theta correction is used for heterozygote
genotypes because, as noted earlier, their frequency of occurrence is already overestimated if
substructure exists in the genotype.

Minimum­allele­frequency
Because allele variants infrequently encountered
in the population may not have been seen in the
population sampling used to create the database,
or the allele variants are underrepresented in
the sampling, labs must have a statistically conservative mechanism for dealing with this situation. NRC II recommends that a minimum allele
frequency value be assigned to any allele that is
or was not observed, or was seen less than 5
times, in the samples constituting the database.

­
67

CHAPTER 6

The minimum allele frequency is calculated using
the formula, 5/2n, where n equals the number of
people in the database, such that 2n represents
the number of possible alleles, given that number of people. Selection of a value of 5 minimum
observations of an infrequently encountered allele
ultimately results in a very conservative value
for these alleles — 5 is an arbitrarily selected
number. Using the example of a database of 150
people: the minimum allele frequency estimate
of alleles not seen or seen less than 5 times =
0.017, or 5/(2 × 150).
As with the correction factor for homozygotes,
population geneticists argue for use of the minimum allele frequency value because this overestimation of frequency will always favor the
defendant.

The­product­rule
The multiplication of the genotype frequencies
across loci is called the product rule. Essentially,
the product rule states that when two events are
independently occurring, the chance that both
will happen at the same time can be determined
or estimated by multiplying the probabilities of
occurrence of each event. The use of the product
rule in statistical calculations has been longstanding in the mathematics, statistics and population
genetics communities.
For the product rule to be legitimately used in
forensic DNA cases, it must be demonstrated
that, at each STR locus, the allele inherited from
the mother is inherited independently of the
allele inherited from the father. It must also be
demonstrated that the STR loci used in DNA typing kits are inherited independently from each
other. Repeated testing of the loci used in STR
DNA typing has demonstrated that the loci are
inherited separately and, therefore, no linkage
between the loci has been found.
Note: The product rule is not used to generate frequency estimates for mtDNA or Y-STRs.
(For more information on reporting results for
Y-STR tests, see the discussion on the counting
method, later in this section.) Some laboratories
multiply RMP frequency and the Y-STR/mtDNA
frequency. This emerging approach was being
litigated as this publication went to press.

­68

Testing­of­databases:­Hardy-Weinberg­­
equilibrium­and­linkage­equilibrium
Most crime labs have been performing DNA testing for some time; it is likely that their databases
have been previously examined to determine
that they met Hardy-Weinberg equilibrium and
linkage equilibrium criteria. Before a lab may use
the product rule, its STR database must meet
the HWE criteria. Check to see whether the lab’s
database has been examined by a statistician or
a population geneticist. If the database has been
previously examined in the course of litigation,
it is unlikely to be an issue. The databases in
common use by crime labs have been reviewed
by an independent expert, and the results were
peer reviewed and published.

Statistics­for­partial­DNA­profiles
A single-source DNA profile that does not contain
complete information from all loci tested is called
a partial DNA profile. A partial mixture DNA profile can also be encountered.
For a partial single-source profile, the RMP calculation is still used. The number will be more
favorable to the defendant with a partial DNA
profile because fewer loci are obtained; thus,
fewer frequencies are multiplied together and
the final statistic is less rare.
For a partial mixture DNA profile, the lab will use
whatever calculation type their protocol requires
— CPI, CPE, MRMP or LR. Again, the number
will be more favorable to the defendant with a
partial mixture DNA profile because results have
been obtained at fewer loci.
Any partial DNA profile provides the best opportunity to refute the significance of the statistical
calculation provided in the lab’s report. Although
partial single-source DNA profiles may still provide strong support for the value of a match, this
will depend on how partial the profile is. Assigning allele calls in partial mixture profiles can be
challenging, as noted in Section 2 of this chapter,
which often translates into challenges in conducting the statistical calculation, depending on
the formulas the lab uses. These often give the
most room for exploring the real value of the failure to exclude someone as a potential contributor to the profile. When attempting to do so, you

DNA

INITIATIVE

DNA BAsiCs: EvAluATiNg TEsT REsulTs

must make sure the jury is aware of the types of
statistical numbers that are usually encountered
in forensic cases. Without such a benchmark for
comparison, a combined probability of inclusion
(CPI) number of 1 in 3,000, or even 1 in 100, may
sound like it isn’t “too bad.”

Statistics­for­mixture­profiles
The commonly used calculations for mixtures
in U.S. crime labs are represented in the table
from the SWGDAM Guidelines (January 14,
2010) reproduced below (see Table 2). What is
clear from the Table is that many choices exist
for calculating the significance of a mixture DNA
profile. This naturally introduces the possibility
that your expert may have a different recommendation for another method for calculating the
statistic.

Strategic­considerations­for­mixture­­
calculations
The RMP approach for mixture calculations
expresses the DNA match in far more incriminating terms than other available approaches. Even
use of a modified random match probability statistic (MRMP) helps to temper use of this statistical approach.
How do the labs justify the use of an RMP
approach? They conclude that it is possible to
separate out (“pull out”) a major (or, in some
cases, a minor) DNA profile in the mixed DNA
sample and then conduct an RMP analysis on
that major profile. Sometimes this is possible
to do, as when a clear DNA profile from a major
contributor can be discerned in the mixture; in
those circumstances, use of an RMP statistic is
appropriate. For reasons discussed elsewhere in
this guidebook, this approach can be problematic
when applied to a mixture DNA profile. It is not
possible to discern the contributor’s profile in the
absence of known samples with which to compare it.
In general, defense counsel’s default should be
to promote use of the CPI/CPE method in any
mixture case because the reported statistic is
almost always more favorable to the defense.

DNA

INITIATIVE

However, labs must use whichever statistical
approach their protocol dictates.
Even with the CPI/CPE method, counsel should
consider how to convey statistical information
to the jury. Psychological studies have shown
that juries better understand the statistical value,
and are less likely to inflate the discriminatory
value of DNA evidence, when presented in the
form reported by CPI. The way CPE results are
worded can be problematic if your client is not
excluded because lab results generally state that
99.998% (or greater, depending on the actual
calculation) of the population can be excluded as
a contributor to the mixture.
Therefore, in mixture cases, defense counsel
should seek to have the significance of the evidence conveyed by their expert to the jury in the
following form, based on the expert’s CPI calculation: “1 in X number of (randomly selected,
unrelated) people in the population would be

Table­2:­Suitable­Statistical­Analyses­for­
DNA­Typing­Results­
Category­of­DNA­
Typing­Result

RMP

CPE/CPI

LR­(1)

Single source

✓

✓

Single major contributor to a mixture

✓

✓

Multiple major contributor to a mixture

✓ (2)

✓ (2)

✓

Single minor contributor to a mixture

✓

✓ (3)

✓■

Multiple minor contributor to a mixture

✓ (2)

✓ (3)

✓

Indistinguishable
mixture

✓ (1)

✓

✓

(1) Restricted or unrestricted; (2) restricted; (3) all potential
alleles identified during interpretation are included in the
statistical calculation.
Notes: The statistical methods listed in the table cannot be
combined into one calculation. For example, combining RMP
at one locus with a CPI calculation at a second locus is not
appropriate. However, an RMP may be calculated for the
major component of a mixture and a CPE/CPI for the entire
mixture (as referred to in section 4.6.2).
Source: Reproduced from SWGDAM Guidelines (January 14,
2010).

­
69

CHAPTER 6

expected to be included as a possible contributor
to the evidence profile.”
It is not reasonable to expect an analyst to conduct any statistical calculation on the stand, particularly one that is different from one routinely
used by their laboratory. Even if you ask for a
break for the examiner to conduct the calculation, many lab protocols prohibit release of any
data without a technical review. Furthermore,
most statistical calculations are fairly complex,
and computers are now routinely used to generate statistics. If you want to present different statistics to the jury, you should plan on using your
own expert to present the testimony.

Counting­method­for­Y-STR­and­mtDNA­­
testing
The counting method is used to report the significance of Y-STR and mitochondrial DNA testing
results. Because of the mode of inheritance of
Y-STR loci and mitochondrial DNA, the statistical
approaches used for autosomal STR loci are not
appropriate — simple Mendelian genetics laws
do not apply to Y-STR and mitochondrial inheritance. The counting method calculates
how many times a profile has been seen in
the consolidated U.S. Y-STR database (http://
usystrdatabase.org) or another appropriate database identified by the lab.
Following is an example using the counting
method approach for a Y-STR haplotype profile:
“The Y-STR profile was seen three times in the
database of ___ × ___ individuals” or, sometimes, “The Y-STR profile was not seen in the
database.”

­70

Statistics­for­related­individuals
The probability of randomly selecting an unrelated individual with a particular genotype is computed as an RMP. Individuals who are related to
one another will share more alleles than unrelated individuals because they have a biological
relative in common. The same alleles will occur
more frequently within a family than in the general population. Thus, for example, a homozygous
profile that may normally be found at a 1% frequency in the general population may be found
at a much greater frequency among relatives. For
example, the expected frequency among full siblings for this same homozygous profile would be
25.5%. Be mindful that once you ask, “What is
the probability that a relative (full sibling, parent,
child, etc.) would have a matching DNA profile,”
you are now asking a completely different question from “What is the probability of randomly
selecting an unrelated individual with a matching
DNA profile?”

Statistics­for­database­searches
For a discussion on statistics for database
searches, see Chapter 9, Section 6.

Endnote­
1. See Risinger, D.M., et al., “The Daubert/
Kumho Implications of Observer Effects in Forensic Science: Hidden Problems of Expectation and
Suggestion,” 90 C alif . l. R e v . 1 (2002); Krane,
D.E., S. Ford, J.R. Gilder, K. Inman, A. Jamieson,
R. Koppl, I.L. Kornfield, D.M. Risinger, N. Rudin,
M.S. Taylor and W.C. Thompson, “Sequential
Unmasking: A Means of Minimizing Observer
Effects in Forensic DNA Interpretation,” 53
J. f oR e ns iC s Ci. 1006 (July 2008).

DNA

INITIATIVE

CHAPTER 7

DNA­Basics:­Pretrial­Preparation
Section­1:­Should­the­Defense­
Request­Testing?
Once the DNA evidence has been evaluated by
the defense’s expert, a decision by the defense
to conduct additional DNA testing should be considered. The defense theory of the case should
be developed before a retest or other DNA testing is started. The following should be considered:
■■

What are you trying to prove with the defense
DNA test?

■■

Is third-party guilt a possibility?

■■

Will DNA testing help refute the prosecution’s
DNA testing?

■■

Will DNA testing help prove a fact that is
important to the case?

It is important to consult with the defense’s
DNA expert on the desirability of testing. It is
also important to meet with the client and obtain
input after discussing the DNA testing process
and the option of conducting DNA testing with
the client. For a discussion on talking to the client, see Chapter 4, Section 1, and Chapter 6,
Section 5.
Once the decision to perform DNA testing is
made, counsel should locate a DNA laboratory
that is experienced in forensic DNA testing. The
laboratory should also be available to testify if a
favorable result is obtained.

Section­2:­Evidentiary­Issues
Three discrete ways DNA acquisition may be
implicated in a criminal investigation or prosecution are as follows:

DNA

INITIATIVE

■■

Collecting a suspect’s DNA before or during
the investigation and matching it to crime
scene evidence.

■■

Collecting DNA from an already charged
defendant to determine whether it matches
crime scene evidence.

■■

Collecting biological material from the defendant’s body, clothing, car, or other possession
that might be shown to belong to the victim.

Each method is likely to implicate the Fourth
Amendment because retrieving biological material from the accused is a seizure, and subsequent
testing is a search. This is made clear by application of the holding in Skinner v. Railway Labor
Executives’ Ass’n.1 In Skinner, the U.S. Supreme
Court made the following points:
■■

“The initial detention necessary to procure the
evidence may be a seizure of the person, if
the detention amounts to a meaningful interference with his freedom of movement.”2

■■

“[C]hemical analysis of urine, like that of
blood, can reveal a host of private medical
facts. ... Because it is clear that the collection
and testing of urine intrudes upon expectations of privacy that society has long recognized as reasonable ... , these intrusions
must be deemed searches under the Fourth
Amendment.”3

Section­3:­DNA­Collection­—­
Databanks­of­Convicted­­
Person­DNA
In 1989, Virginia became the first state to pass
legislation requiring certain classes of criminal
offenders to submit to DNA testing for the purpose of including the DNA samples in a DNA
databank.4 Virginia legislation also provided that

­71

CHAPTER 7

DNA evidence was admissible evidence of identity in criminal proceedings.5

Does­a­databank­match­establish­­
probable­cause?

Over the next 10 years, all other states enacted
laws requiring the collection of biological samples from certain criminals for inclusion in databanks. Some states require that DNA samples be
taken from all classes of felons; other states also
include individuals convicted of certain misdemeanors. All states require the collection of DNA
samples from convicted sex offenders.6

A match between DNA recovered from a crime
scene and a defendant’s databank (or otherwise lawfully obtained) profile— without more
evidence — does not establish probable cause to
arrest. Just as a fingerprint may be left at a crime
scene in any number of innocent ways,14 so, too,
may a defendant’s DNA be retrieved from evidence innocently left near the location, such as a
cigarette butt. Probable cause can be found only
with additional facts that make it likely that the
criminal left the item.15

A federal statute — known as the DNA Analysis
Backlog Elimination Act of 2000 — was enacted
on December 19, 2000.7 The statute mandates
the collection of DNA samples from individuals
in custody or on probation, parole or supervised
release if they have been convicted of certain
qualifying federal offenses, such as murder, voluntary manslaughter, other homicide offenses,
kidnapping, robbery or burglary.8 Convictions for
certain federal offenses relating to sexual abuse,
sexual exploitation or other abuse of children;
transportation for illegal sexual activity; certain
felony offenses relating to sexual incest; and
crimes of violence also trigger the DNA sample
collection requirement.9 To protect the privacy
rights of individuals subject to this requirement,
the federal statute limits the purposes for which
DNA samples or results may be used and the
circumstances under which they may be disclosed.10 The federal statute also makes it a
crime to obtain a DNA sample or result without
proper authorization.11
State and federal statutes that require the collection of DNA samples from certain classes of
convicted criminals have been the subject of
various constitutional challenges, virtually all of
them unsuccessful. In particular, Fourth Amendment challenges12 have been rejected, regardless of the court’s analytic approach. Absent
action from the U.S. Supreme Court overturning
these decisions — or unless their reach is found
not to apply to certain categories of individuals,
such as juveniles, arrestees, or people who have
completed their probation, parole or supervised
release — it will be difficult to challenge subsequent comparisons between an evidence profile
and databank profiles from known individuals.13

­72

Section­4:­DNA­Collection­—­
Taking­DNA­From­an­Arrested­
Person­by­Judicial­Order
Some states require DNA testing of any person charged with a specified offense (e.g., a
felony).16 If the resulting DNA profile matches a
crime scene profile, the following suppression
issues should be examined:
■■

Was there probable cause for the arrest?

■■

Was the arrest for one of the designated
offenses?

■■

Does the legislation mandating DNA testing
of arrestees violate the Fourth Amendment
or the state’s constitutional protection against
unreasonable searches and seizures? Does it
violate another provision such as a state constitution’s privacy guarantee?

To date, courts are divided on whether mandatory testing of all arrestees (or all arrestees for
designated offenses) is unconstitutional. This
issue is likely to receive more attention: Federal
legislation enacted in 2006 allows DNA testing
of all individuals arrested for federal criminal
felonies, and more states are moving toward
arrestee databanks.
In In re Welfare of C.T.L.,17 the Minnesota Court
of Appeals forbad arrestee testing, deeming it
a search for evidence with no probable cause
determination:

DNA

INITIATIVE

DNA BAsiCs: PRETRiAl PREPARATioN

By directing that biological specimens be
taken from individuals who have been
charged with certain offenses solely because
there has been a judicial determination of
probable cause to support a criminal charge,
[these statutes] dispense with the requirement under the Fourth Amendment that
before conducting a search, law enforcement
personnel must obtain a warrant based on a
neutral and detached magistrate’s determination that there is a fair probability that the
search will produce contraband or evidence
of a crime. Under the statute, it is not necessary for anyone to even consider whether
the biological specimen to be taken is related
in any way to the charged crime or to any
other criminal activity.18
The Minnesota Court of Appeals also focused on
the defendant’s privacy interest with regard to
his or her DNA.19
By contrast, the Virginia Supreme Court ruled in
2007 that such legislation is constitutional, finding that it is an identification procedure rather
than evidence gathering. The court reasoned,
“Like fingerprinting, the Fourth Amendment
does not require an additional finding of individualized suspicion before a DNA sample can be
taken.”20
As a general matter, on the privacy interest
dimension, there is a continuum from prisoners
(who have little or no reasonable expectation of
privacy) to parolees, then probationers. It can be
argued that arrestees, especially ones who are
ultimately acquitted or have the charges against
them dismissed, should have the full privacy
interests afforded by the Fourth Amendment.

Probable­cause
When there is no statutory authorization for
across-the-board DNA “fingerprinting” of arrestees, judicial order must precede DNA testing of
a pretrial defendant (absent consent, discussed
later). In light of Skinner 21 and its prequel holdings, including Schmerber v. California,22 the
likely standard is a warrant or judicial order predicated on probable cause. As the U.S. Supreme
Court explained in Skinner:
In most criminal cases, we strike this balance
in favor of the procedures described by the

DNA

INITIATIVE

Warrant Clause of the Fourth Amendment.
See United States v. Place, supra, at 701,
and n. 2; United States v. United States District Court, 407 U.S. 297, 315 (1972). Except
in certain well-defined circumstances, a
search or seizure in such a case is not reasonable unless it is accomplished
pursuant to a judicial warrant issued upon
probable cause. We have recognized exceptions to this rule, however, “when ‘special
needs,’ beyond the normal need for law
enforcement, make the warrant and probable-cause requirement impracticable.”23
Although this language seems dispositive on the
issue of whether the probable cause standard
must be met, final analysis will depend on the
level of intrusiveness found in a DNA search. In
an earlier decision, the U.S. Supreme Court held
that the fingerprinting of individuals might be
allowed during lawful Terry 24 stops on the basis
of reasonable suspicion.25 Several states have
upheld orders for DNA testing on the basis of
a judicial determination that there is reasonable
suspicion the individual is a suspect.26 However,
in those decisions, the testing occurred prearrest or pursuant to a grand jury subpoena.
Because of privacy concerns, the U.S. Supreme
Court has characterized compelled intrusions
into the body to seize blood samples as Fourth
Amendment searches.27 Accordingly, to obtain
a warrant or court order for a blood sample, the
government must show that probable cause
exists to believe that the blood sample will produce evidence of the defendant’s involvement
in the crime.28 Thus, it is likely that the probable
cause standard will apply post-arrest. All of this
is predicated on there being a lawful arrest or
detention; if it is unlawfully seized, a DNA “fingerprint” must be suppressed as the fruit of the
“poisoned” seizure.29

Testing­crime­scene­evidence­before­
requesting­a­defendant’s­sample
Assuming the defendant is lawfully in police custody, a related concern is whether the prosecution must test the crime scene evidence to see if
a DNA profile likely to be that of the perpetrator
has been found before requesting the defendant’s DNA sample. This is significant, because,
once the police have the defendant’s profile, it

73

CHAPTER 7

can also be checked against evidence from other
crimes or uploaded into DNA databases. With
these concerns apparently in mind, the ABA’s
Standards for DNA Evidence require as a prerequisite that there first be a judicial determination “that the sample will assist in determining
whether the person committed the crime.”30
The probable cause standard is the ultimate test
for such searches. The U.S. Supreme Court has
provided some guidance, however, stating that
the government must establish not simply a
“mere chance” that the extraction of blood will
produce relevant evidence but “a clear indication
that in fact such evidence will be found [through
the compelled bodily intrusion].”31
Nonetheless, courts have typically issued such
orders after either a DNA profile has been
extracted from crime scene evidence32 or the
type of crime scene evidence (e.g., sperm)
makes it clear that a profile will be obtained.33
A mere “boilerplate” allegation — that it is
“important in the investigation to take venous
blood and saliva samples for comparison and/or
elimination ... with no factual allegations whatsoever to demonstrate that the desired evidence
would be found” — will be deemed insufficient.34
Courts analyzing the reasonableness under the
Fourth Amendment of orders for blood samples,
buccal swabs, hair samples and other bodily
intrusions have closely scrutinized the government’s claims for the need for such intrusions.
Courts have required a clear showing that the
intrusion will produce evidence.
For example, in In re Lavigne,35 the Supreme
Court of Massachusetts reviewed the government’s request for a blood sample for use in
its homicide investigation. The government did
not offer evidence that it had relevant samples
to which the defendant’s blood could be compared. The Lavigne court held that the defendant
was entitled to a hearing where the judge was
required to “make findings as to the degree
of intrusion and the need for the evidence of
the blood sample.”36 The court noted that the
government bore the burden of establishing
a “nexus between the item to be seized and
criminal behavior,”37 and that an order compelling the defendant to provide a blood sample was
unreasonable unless the government established
such a nexus. The court ordered the return of

­74

the blood sample that had been taken from the
defendant.38
Similarly, in State v. Acquin,39 the government
sought to seize the blood of a defendant in a
murder case. The government was in possession
of items believed to be the murder weapons,
which bore reddish sticky substances that could
have been blood. Relying on Schmerber and
Hayden, the Supreme Court of Connecticut held,
“In the absence of facts establishing, at the very
least, that the ‘substance’ found on the alleged
murder weapons was in fact blood,” the court
could not find probable cause to believe that the
blood seized from the defendant would have a
nexus to the crime charged.40

Section­5:­DNA­Collection­—­
Taking­DNA­From­an­Arrestee­
Without­a­Warrant
Because a person’s DNA profile remains constant, there is no exigency that would entitle the
police, without a warrant, to seize the suspect’s
biological material for DNA testing once the suspect is in police custody.41 However, exigent circumstances may arise when the defendant may
have DNA evidence from the alleged crime victim on his or her person or clothing (for example,
when a suspect is arrested within hours of an
alleged sexual assault or homicide).
U.S. Supreme Court precedent permits warrantless seizures in such limited circumstances. In
Cupp v. Murphy,42 the Supreme Court approved
the taking of apparent blood under the fingernails
of a murder suspect, without a warrant, within
hours of the crime because it was a “very limited
search necessary to preserve the highly evanescent evidence they found under his fingernails.”
Subsequent to Cupp, the Supreme Court held
that clothing worn by a person arrested on the
basis of probable cause may be seized and
checked for crime scene evidence without police
first needing to secure a warrant.43 This principle
has been applied to taking an arrestee’s clothing to check for DNA.44 The same applies when
police want to swab the arrested person’s genitals, hands, or other body parts in search of the
alleged victim’s bodily fluids. The analysis will
turn on the proximity of the arrest to the time the

DNA

INITIATIVE

DNA BAsiCs: PRETRiAl PREPARATioN

crime occurred and whether there is any likelihood that the defendant could wash, shower, or
otherwise remove the biological material before
a warrant could be obtained.45
The taking of a DNA sample does not automatically confer the right to upload that profile into a
local, state or national databank.

Section­6:­Alternative­Methods­
of­Obtaining­DNA­Evidence­—­
Consent
The doctrine governing consent searches is twopronged: Consent must be voluntary46 and the
scope of consent is governed by the natural language used by the parties.47 Acquiescence to an
explicit request for a DNA profile, if made without coercion, will be presumptively voluntary.
In the DNA context, three situations may raise
concerns about the validity or proper scope of
consent. First, police may ask for an item (e.g.,
a piece of hair or a hat) from which DNA can
be extracted without telling the person of their
intent to test it and obtain a DNA profile. A
motion seeking to suppress the resulting DNA
profile will be determined by (a) the language
that was used by the police when asking for
the item (e.g., “We want your hat to show it to
witnesses”)48 and (b) whether surrender of the
item eliminates any reasonable expectation of
privacy.49
The second consent paradigm is one in which
the police ask for a person’s DNA, ostensibly to
compare it with the evidence from a particular
crime scene, but instead compare it to crime
scene evidence from another crime or several
other crimes. Courts addressing this practice
have approved it, focusing on the loss of an
expectation of privacy of the DNA profile. They
have not discussed the separate issue of whether the scope of consent has been exceeded.50
This practice comes into play when a DNA profile
is sought for comparison with evidence from one
crime scene but is then uploaded into a local,
regional or national DNA databank. Law enforcement has increasingly used DNA dragnets to
collect genetic information that is sometimes
entered into DNA databanks.51 In a DNA drag-

DNA

INITIATIVE

net, law enforcement officers investigating a
particular offense ask the eligible population of a
community for “voluntary” DNA samples. After
the investigation, police might then request submission of the generated profiles of these innocent people to DNA databanks. It is important to
note that, under the current regulations dictating
what samples are suitable for submission to
the national CODIS (NDIS), no suspect samples
(volunteered or otherwise) can be submitted to
NDIS. However; if the crime laboratory practices
and state laws allow, they can be uploaded to
the local CODIS (LDIS) and potentially the state
CODIS (SDIS), if approved by the state CODIS
administrator).
The decisional law analyzing such practices is
limited, but some courts have found that relinquishing one’s DNA profile to police ends all
expectations of privacy.52 As the Virginia Court of
Appeals explained:
[T]he overwhelming weight of relevant
authority from our sister states indicates that
society is unwilling to recognize as reasonable the subjective expectation of privacy
infringed by the government when a DNA
sample validly obtained from a suspect in
one criminal case is used to analyze and
compare the suspect’s DNA in an unrelated
criminal case.53
However, “voluntary” consent in DNA dragnet
situations may be illusory. Individuals asked to
give samples in DNA dragnets are often unaware
of their right to refuse. It is important to be mindful of the potential that some police officers may
have used coercive measures to obtain consent
in DNA dragnets, such as threatening — implicitly or explicitly — that individuals who do not volunteer their DNA will become suspects.54
Police also may have reason to take a person’s
DNA, without his or her consent, in the context
of a particular case, but they may not have the
right to put that information into a DNA databank.
For instance, in the “BTK” serial killer case, the
police, with probable cause, searched a suspect’s home and collected a genetic sample,
which did not match the evidence sample.55 A
court granted the suspect’s motion to have his
DNA profile purged from law enforcement databanks.56

75

CHAPTER 7

Section­7:­Alternative­Methods­
of­Obtaining­DNA­Evidence­—­
Abandoned­Property
The Fourth Amendment has been held to permit police to seize abandoned property, that is,
property that has been left in a public location
in a manner accessible to others.57 Unless in a
jurisdiction where state constitutional protections
are greater,58 this means that police (or private
parties acting at the behest of law enforcement)
may seize any item believed to contain a suspect’s DNA if that item has been “abandoned.”
Cases of DNA seizures involving abandoned
property include collecting a suspect’s saliva:
■■

After he or she spits on a public street.59

■■

After police create a ruse and mail a letter purportedly from a law firm inviting the suspect
to join in a lawsuit, and his or her saliva is on
the return envelope.60

■■

From a soda can that police offered a suspect,
who drank the soda and then threw the can in
the trash.61

It is only when the allegedly abandoned item is
still on the defendant’s private property — or
otherwise in circumstances where an expectation of privacy is retained — that seizure of the
item must comply with Fourth Amendment
protections.62
The U.S. Supreme Court has not yet made a
determination of whether DNA left on a soda
can, an envelope or some other collectible item
may be collected under the doctrine of abandonment. Whether such seizures should be subject
to Fourth Amendment scrutiny because of the
vast amount of private information contained in
DNA is still an open question. A person may have
a higher expectation of privacy for the personal
information contained in DNA than for the item
that police found and used for forensic DNA testing. Thus, any subsequent testing of such surreptitiously found information and the potential for
its inclusion in a local or state databank — even
the initial collection of the item — may violate
the individual’s Fourth Amendment rights.

­76

Section­8:­Scientific­Evidence­
Admissibility­Standards
Advances in the use and validation of conventional DNA technologies have led courts to
admit DNA evidence on the national level under
Daubert,63 Frye64 or other standards.65 This is
particularly true for nuclear (autosomal) DNA
(nDNA).66 Some courts have also approved the
admission of mtDNA67 and Y-STR68 test results
under their relevant admissibility standards.
However, these latter two technologies may still
remain open to challenge. Challenges may also
be valid for more novel technologies or those
that have not been in use for long, alternative
applications of existing technologies, and future
developments.
Even when the DNA technology has been
accepted, an admissibility hearing may be
allowed in some jurisdictions to see whether
the testing, analysis and conclusion in a particular case meet the applicable standard.69 Other
jurisdictions require looking at the weight of the
evidence and not the threshold admissibility.70
Counsel should consider whether it is more
advantageous to expose any deviations from protocol in an admissibility hearing or wait for trial.

Section­9:­Motions­in Limine­—­
Statistics­Issues
Regardless of threshold admissibility, the DNA
evidence offered by the government may be
challenged at pretrial, under the following Federal
Rules of Evidence (FRE):
■■

FRE 401, as lacking in relevance.

■■

FRE 403, as having limited relevance that is
substantially outweighed by the risk of unfair
prejudice.

The latter issue arises in cases where the crime
scene evidence yields only a partial DNA profile
that matches the defendant or the defendant is
one of the DNA contributors. The lower the number of loci where alleles are found in the crime
scene evidence and/or the higher the number of
callable alleles at the majority of loci, the greater
the likelihood of unfair prejudice and the risk of
juror confusion.

DNA

INITIATIVE

DNA BAsiCs: PRETRiAl PREPARATioN

As a general rule, testimony about partial DNA
profiles with low statistical significance has been
admitted, with restrictions, during the prosecution’s argument to avoid jury misinterpretation.71
In particular, courts must be responsive to the
risk of what is termed the prosecutor’s fallacy:
Defendant Palmer also cites to what is more
formally called “the fallacy of the transposed
conditional, or the prosecutor’s fallacy.” This
fallacy represents incorrect reasoning — i.e.,
when the jury “will confuse the probability
of a random match with the potentially very
different probability that the defendant is not
the source of the matching samples.” …
[T]he Government must be “careful to frame
the DNA profiling statistics presented at trial
as the probability of a random match, not
the probability of the defendant’s innocence
that is the crux of the prosecutor’s fallacy.”
While this is a very real danger, the courts
that have dealt with this potential problem
have found that careful oversight by the district court and proper explanation can easily
thwart this issue.72
When the random match probability is high —
that is, when the allele combination is found
with great frequency across the population — an
argument can be made for absolute exclusion
of the evidence because of the high likelihood
of confusion and the low probative value of the
proof. For example, the evidence was properly
excluded in a case where “the random match
probability with respect to the DNA detected on
the [evidence] was approximately 1 in 2 from the
African-American population.”73
Thus, when the prosecution offers partial match
evidence, the defense counsel can seek exclusion under Rule 403. If exclusion is denied, seek
to ensure that the expert testimony and the
prosecution’s argument are carefully restricted
so that the evidence is not misrepresented or
misused.
Of note is that, in light of the current version of
the SWGDAM Guidelines — which require the
conduct of a statistical analysis in support of any
inclusion that is determined to be relevant in the
context of the case (Guideline 4.1) — the possibility of the prosecution seeking to use a
potentially highly prejudicial statistic is likely to
occur much more frequently. In the past, the

DNA

INITIATIVE

laboratory had the discretion to decide if providing a statistic for a partial profile that contained
very little identifying information — but still
included a suspect — would be likely to be more
prejudicial than helpful. This is no longer the
case. Although, in general, the statistics for the
DNA typing results that provide the most genetic
information and/or the highest discrimination
potential are to be reported (Guideline 4.1.1), if a
report’s conclusion statement for a partial profile
result includes the suspect and that partial profile is the only profile generated, the SWGDAM
Guidelines require that a statistical number be
attached — no matter how little data can be
derived from the profile.

Section­10:­Motions­in Limine­—­
Presence­of­the­Defendant’s­DNA­­
in­the­Databank
When a “cold hit” or databank check results
in the defendant’s identification as a suspect,
counsel should file a motion in limine seeking
to preclude testimony regarding this investigative technique. How the defendant came to be
a suspect is rarely persuasive. Once jurors learn
that the defendant’s DNA was in a databank, the
inevitable conclusion is that the defendant has a
prior criminal record.
This is similar to showing a suspect’s mugshot,
a term that clearly connotes a criminal record.
Calling it a photograph can help “sanitize” the
idea of a mugshot; however, there is no parallel
method for “cleansing” the reference to a DNA
databank. The following objections should be
made:
■■

Such proof has no relevance, as the databank
hit is not necessary to the proof of guilt;74
under Rule 404(b), such evidence only establishes the suspect’s bad character.75

■■

Under Rule 403, any potential probative value
is substantially outweighed by the likelihood
of unfair prejudice, to wit, the diminution or
removal of the presumption of innocence.76

When the defendant has been identified through
a databank hit, there may also be concerns about
how the probability statistics were calculated.
For a discussion on database statistics, please
see Chapter 9, Section 6.

77

CHAPTER 7

Section­11:­Motions­in Limine­—­
Hearsay,­Confrontation­and­DNA­
Evidence
Both tactical and legal questions arise when a
prosecutor attempts to introduce DNA evidence
by submitting lab report results. When the DNA
results are not in dispute, it may be to the tactical advantage of the accused for the results to
be introduced in a brief, nondramatic reading.
However, when results (or conclusions derived
from results) are in dispute or when the defense
is concerned about identifying and preserving
potential appellate issues, a hearsay or Confrontation Clause challenge may be appropriate.
A hearsay challenge to a lab report may be viable
under state evidence codes if the report does
not qualify as a business record because it is prepared for litigation. If the state business records
exception does not include such a limitation, a
challenge may be brought under Confrontation
Clause principles.
In Crawford v. Washington,77 the U.S. Supreme
Court reconfigured Confrontation Clause analysis as applied to hearsay in criminal trials. The
Supreme Court concluded that the right of confrontation restricted only the admission of testimonial hearsay; the Supreme Court intimated
that typical business records would be outside of
that classification.78
Notwithstanding that dictum, many courts have
found forensic lab reports to be testimonial hearsay, and thus inadmissible, if the lab examiner is
not present for cross-examination.79 Treatment of
DNA analyses has been mixed, with some courts
finding the reports to be testimonial80 and others
concluding that the reports are nontestimonial
and thus not subject to Confrontation Clause
challenge.81
A more recent decision determined that the
analyst must introduce a DNA report and findings by live testimony rather than submitting the
document(s) or an affidavit (unless the accused
waives his or her right of confrontation). In
Melendez-Diaz v. Massachusetts,82 the U.S.
Supreme Court held that, for Confrontation
Clause purposes, a lab analyst is as much a witness as someone who observes the crime. The

­78

Supreme Court also ruled that lab reports are not
admissible as business records because they are
intended for use in court and are “a record for
the sole purpose of providing evidence against a
defendant.”83
This raises questions over the constitutionality
of having an analyst other than the one who ran
the tests serve as the in-court witness. Although
the Supreme Court did not address this directly
in Melendez-Diaz, its language makes this practice problematic for confrontation purposes. As
the Supreme Court noted, the accused needs
to know “what tests the analysts performed,
whether those tests were routine, and whether
interpreting their results required the exercise
of judgment or the use of skills that the analysts
may not have possessed.”84 By definition, the
person who technically reviewed the case file is
equally qualified to answer these questions. The
Supreme Court explained that cross-examination
helps ensure that methods were applied reliably.
It emphasized the difference between a witness
who can authenticate the document and one
who may testify as to its contents:
[A] clerk ... [may be] permitted to certify to
the correctness of a copy of a record kept
in his office but [has] no authority to furnish,
as evidence for the trial of a lawsuit, his
interpretation of what the record contains
or shows, or to certify to its substance or
effect.85
Thus, if the analyst who performed the test (and/
or the technical case file reviewer) is no longer
available to testify, confrontation principles may
bar a replacement witness from testifying unless
that person conducts the testing and analysis
again.86
In Melendez-Diaz, the Supreme Court did
approve of “notice-and-demand” statutes —
laws or rules of procedure that require the prosecution to give notice of its “intent to use an
analyst’s report as evidence at trial, after which
the defendant is given a period of time in which
he may object to the admission of the evidence
absent the analyst’s appearance live at trial.”87
However, the constitutionality of provisions that
place an initial burden on the defendant to subpoena the analyst was left unresolved.88

DNA

INITIATIVE

DNA BAsiCs: PRETRiAl PREPARATioN

Melendez-Diaz makes clear that, for confrontation purposes, the critical witness is the analyst
— not individuals with peripheral involvement
such as “chain of custody” witnesses. The
Supreme Court noted that chain of custody may
be proved circumstantially and that the chain
need not be completely unbroken in order for
evidence to be admissible.
Thus, before a DNA report or test result is introduced at trial, defense counsel must determine
whether it is desirable to have that proved in
court with live testimony. Subsequently, counsel must determine whether the prosecution’s
method of presenting the results aligns with the
defendant’s confrontation rights.

Section­12:­Admitting­Evidence
CODIS­searches­of­partial­and­­
mixture­profiles
Not all CODIS hits have 13 loci that match. In
some cases, the crime scene evidence may be
degraded and have identifiable alleles at some,
but not all, of the tested loci. In other cases, the
crime scene DNA may yield a full (13-loci) profile,
but there may not be an offender or arrestee
in the database who fully matches the profile.
When this happens with a single-source DNA
profile, the typical CODIS search will, with rare
exception, come back as stating that no matches
were detected. Both circumstances have different potential consequences in a criminal case.
When the crime scene evidence is degraded
and a 13-loci profile cannot be generated, the
evidence can still be searched against databank
profiles developed from other evidence and
convicted offender/arrestee profiles. In a databank search, if there is a mismatch between
the offender’s/arrestee’s or previously existing
evidence profile at more than one allele, the
offender/arrestee or casework profile will not
be returned during the search as potentially
matching the newly entered partial evidence
profile, even when very limited typing results are
obtained. However, if there are no mismatches
or only one mismatch between the offender’s/
arrestee’s or previously entered casework profile and the newly entered partial evidence profile, the offender/arrestee or casework profile will
be returned on the list of matching profile(s).

DNA

INITIATIVE

In these cases where a hit has occurred, the
issues are (1) a threshold of relevance and (2) a
secondary concern of unfair prejudice. Evidence
is relevant if it has any tendency to make a fact
of consequence more or less probable. Applying
that modest standard, courts have found that
even a partial match to DNA evidence is relevant;
it is no different than proof that the suspect and
the perpetrator had the same color hair or drove
the same type of vehicle.89
As previously stated, the problem with a partial
DNA profile developed from crime scene evidence is the risk of juror confusion and misinterpretation of the statistics — and this is even
before the issue of a databank hit is taken into
account. A statistical probability of 1 in 2 —
which means that one in every two people within
the appropriate population group have the same
trait — may be misunderstood by jurors as there
being a 1-in-2 chance that the DNA came from
the suspect. Because of this risk, courts have
either placed strictures on prosecution arguments to ensure the clarity of the evidence90 or
have excluded the DNA evidence entirely under
a Rule 403 analysis.91
When confronted with such evidence, defense
counsel would be well advised to consider:
■■

Ensuring that a comprehensive review has
been conducted of the testing results obtained
from the crime scene evidence to see
whether there might be an identifiable allele
at another locus or loci that might exclude the
defendant.

■■

Consulting with an expert to ensure an understanding of the statistics.

■■

Moving in limine to exclude the testimony or
restrict prosecutorial argument on its significance to ensure that it is not misstated.

■■

Presenting a defense expert to ensure that the
low statistical significance of the evidence is
made clear to the jury.

■■

Securing a jury instruction that clarifies the limited strength of the proof.

■■

Making appropriate objection to any prosecutorial argument that misstates the evidence.

Another problem arises when a partial DNA profile is generated and there is no known suspect.
The crime lab will upload the partial DNA profile

79

CHAPTER 7

into their local, state and/or national database(s),
provided that it meets the criteria for upload.
The defense cannot object to such an investigative tool, as there is no basis for objection (and,
indeed, no defendant at the time of the search).
As indicated above, searches are governed by
the rules of the particular databank and whether
it can accept partial profiles. If the search parameters are met, a large number of matching profiles may be generated, even when a relatively
high number of loci are available.92 When such
evidence is used to generate a suspect and initiate a prosecution, at least two concerns arise.
First, there is debate over which model to use
when calculating the statistical probability:
Should it be assessed as the probability of randomly matching that profile in the offender/
arrestee databank or in terms of the rarity of the
DNA profile in the population as a whole?93 Use
of a statistic that incorporates the size of the
offender databank raises a concern that the jury
will learn of the defendant’s prior arrests or
convictions.
Counsel should explore whether to challenge the
statistics used by the prosecution and whether
to avoid reference to the defendant having been
in the offender or arrestee databank. A motion
in limine to resolve this must be litigated pretrial. Counsel should seek a resolution that uses
the lower statistic and precludes mention of an
offender database match.
Just as a partial profile may be uploaded to
generate leads, a complete crime scene profile
may be checked against the DNA databank and
may closely — but not completely — match
someone in the pool of arrestees and offenders.
Failure to match fully at more than one locus will
exclude the individual in the databank search,
which precludes this from becoming a problem.
However, a modified search that allows for more
mismatches can be initiated by the lab such that
profiles with a high correspondence of matching
alleles at the remaining loci may turn up on a list
of “nearly matching” profiles. The indication may
be that the perpetrator is a relative of the “nearmatch” individual.
Leads generated through databank checks that
then focus police attention on relatives are called
“familial DNA searches.” The use of familial DNA

­80

searches is projected to increase the crimesolving rate from the current 10% to 14%.94
England and Wales have extensively applied
these types of searches.95 In 2006, the FBI
changed its policy to allow familial DNA searches
using CODIS.96 More recently, states have
debated whether to permit such testing. California announced a formal adoption of familial DNA
searches,97 whereas Maryland’s 2008 legislation
authorizing DNA testing of violent crime arrestees bans familial DNA investigations.98
Familial DNA searches are of primary interest
and receive extensive attention in the media,99
within the forensic science and law enforcement
communities,100 and in legal research and
scholarship.101
The results (if any) from a familial DNA search
will not be conclusive, but they will provide
investigative leads. In this regard, these leads are
analogous to a partial license plate number from
a vehicle observed at a crime scene. Police may
identify numerous cars with the partial plate but,
without more information, there is no probable
cause to arrest.
From the defense perspective, the legal issues
will arise from what the police do next — which
family members are targeted, and whether
and how police obtain DNA profiles from those
individuals. If a family member or relative ends
up “matching” the crime scene profile and is
arrested, counsel will need to address the search
and seizure issues that arose from obtaining
the person’s sample (see Chapter 7, Section 2).
Unless DNA is obtained by consent, court order
or warrant, or from the relative’s abandoned
property, the results of any comparison will be
suppressible as fruits of unlawful searches and
seizures. In addition to Fourth Amendment concerns, defense counsel should examine whether
any state constitutional provision or law was violated in the conduct of such searches (or in the
initial databank search).

Uploading­partial­profiles­to­CODIS
As previously discussed, the local or casework
lab has the option of uploading partial profiles
into its local databank, and in some cases the
state databank, to see if there are any matches
that can be used to generate leads for further
investigation.

DNA

INITIATIVE

DNA BAsiCs: PRETRiAl PREPARATioN

The limits on this practice will be determined by
the rules of the jurisdiction’s databank. Current
CODIS protocol permits uploading partial DNA
profiles into the National DNA Index System
(NDIS) if identifying alleles are obtained for at
least 10 of the 13 core loci. Criteria for uploading into the State DNA Index System (SDIS) vary
from state to state. Local DNA Index System
(LDIS) uploading requirements are dependent on
local agencies’ protocols.
When samples are uploaded, they typically
remain in the databank permanently. An option
separate from uploading is often called a “keyboard search,” whereby a one-time search of a
partial profile is conducted against all of the resident profiles in the databank at that time. Such
an option will depend on the jurisdiction’s applicable laws or a court order. (See Chapter 9, Section 13, and Chapter 10 for more information.)

Searching­CODIS­for­less­than­a­perfect­
13-loci­match
As indicated earlier, when the search of a DNA
profile fails to produce a match or hit, a search
may be initiated for close matches. These
searches seek to locate individuals in the databank with a higher than expected number of
matching alleles — this number will vary depending on the relationship between the individual
in the databank and the source of the searched
DNA profile. The search parameters can be set
to look for a full sibling, parent, child, or some
other defined relationship. The more remote the
biological relationship, the broader the search
algorithm must be set, which translates into a
larger number of close matches in the search
report.
The search report result will be a list of individuals that may contain a person who is a relative
of the actual perpetrator.102 For example, if a
search was set up to look for a full sibling in the
national databank, and the resulting search report
were to list 18 people who had one or two alleles
matching the crime scene profile at 11 of the 13
loci, police might want to investigate relatives of
those 18 individuals.

Endnotes
1. 489 U.S. 602, 616 (U.S. 1989).
2. Id. (citations omitted).
3. 489 U.S. at 617. See also Maclin, “Is Obtaining an Arrestee’s DNA a Valid Special Needs
Search Under the Fourth Amendment?” 34 J.
L. M e d . & e thics 165 (Summer 2006); and Kaye,
“Who Needs Special Needs? On The Constitutionality of Collecting DNA and Other Biometric
Data from Arrestees,” 34 J. L. M e d . & e thics 188
(Summer 2006).
4. See Va. Code Ann. 19.2-310.2.
5. Va. Code Ann. 19.2-270.5.
6. See Ala. Code 36-18-24; Alaska Stat.
44.41.035; Ariz. Rev. Stat. Ann. 13-610; Ark.
Code Ann. 12-12-1109; Cal. Penal Code 290.7;
Colo. Rev. Stat. 17-2-201; Conn. Gen. Stat.
Ann. 54-102g; Del. Code Ann. tit. 29, § 4713;
Fla. Stat. Ann. 943.325; Ga. Code Ann. 24-4-60;
Haw. Rev. Stat. 706-603; Idaho Code 19-5507;
730 Ill. Comp. Stat. Ann. 5/5-4-3; Ind. Code Ann.
10-1-9-10; Iowa Code Ann. 13.10; Kan. Stat.
Ann. 21-2511; Ky. Rev. Stat. Ann. 17.170; La.
Rev. Stat. Ann. 15:609; Me. Rev. Stat. Ann.
tit. 25, § 1574; Md. Ann. Code art. 88B, § 12A;
Mass. Gen. Laws Ann. ch. 22E, § 3; Mich. Stat.
Ann. 28.171; Minn. Stat. Ann. 609.117; Miss.
Code Ann. 45-33-37; Mo. Ann. Stat. 650.055;
Mont. Code Ann. 44-6-102; Nebraska Rev. Stat.
29-4106; Nev. Rev. Stat. 176.0913; N.H. Rev.
Stat. Ann. 651-C:2; N.J. Stat. Ann. 53:1-20.20;
N.M. Stat. Ann. 29-16-6; N.Y. Exec. Law 995c; N.C. Gen. Stat. 15A-266.4; N.D. Cent. Code
31-13-03; Ohio Rev. Code Ann. 2901.07; Okla.
Stat. Ann. tit. 74, 150.27a(A); Or. Rev. Stat.
137.076; 42 Pa. Cons. Stat. Ann. 4701; R.I. Gen.
Laws 12-1.5-8; S.C. Code Ann. 23-3-620(B)(1);
S.D. Codified Laws 23-5A-1; Tenn. Code Ann.
40-35-321; Tex. Gov’t Code Ann. 411.1471; Utah
Code Ann. 53-10-403; Vt. Stat. Ann. tit. 20, 1933;
Va. Code Ann. 19.2-310.2; Wash. Rev. Code Ann.
43.43.754; W. Va. Code 15-2B-6; Wis. Stat. Ann.
165.76; Wyo. Stat. Ann. 7-19-403.
7. 42 U.S.C. § 14135 et seq.

DNA

INITIATIVE

81

CHAPTER 7

8. See 42 U.S.C. § 14135a(d). The federal
statute provides:
(a) Collection of DNA samples.
(1) From individuals in custody. The
Director of the Bureau of Prisons
shall collect a DNA sample from
each individual in the custody of the
Bureau of Prisons who is, or has
been, convicted of a qualifying Federal offense (as determined under
subsection (d)) or a qualifying military offense, as determined under
section 1565 of title 10, United
States Code.
(2) From individuals on release, parole
or probation. The probation office
responsible for the supervision
under Federal law of an individual
on probation, parole or supervised
release shall collect a DNA sample
from each such individual who is,
or has been, convicted of a qualifying Federal offense (as determined
under subsection (d)) or a qualifying military offense, as determined
under section 1565 of title 10,
United States Code.
(3) Individuals already in CODIS. For
each individual described in paragraph (1) or (2), if the Combined
DNA Index System (in this section
referred to as “CODIS”) of the Federal Bureau of Investigation contains
a DNA analysis with respect to that
individual, or if a DNA sample has
been collected from that individual
under section 1565 of title 10, United States Code, the Director of the
Bureau of Prisons or the probation
office responsible (as applicable)
may (but need not) collect a DNA
sample from that individual.
(4) Collection procedures.
(A) The Director of the Bureau of
Prisons or the probation office
responsible (as applicable) may
use or authorize the use of
such means as are reasonably

­82

necessary to detain, restrain
and collect a DNA sample from
an individual who refuses to
cooperate in the collection of
the sample.
(B) The Director of the Bureau of
Prisons or the probation office,
as appropriate, may enter into
agreements with units of State
or local government or with
private entities to provide for
the collection of the samples
described in paragraph (1) or
(2).
(5) Criminal penalty. An individual from
whom the collection of a DNA
sample is authorized under this subsection who fails to cooperate in the
collection of that sample shall be:
(A) Guilty of a class A misdemeanor; and
(B) Punished in accordance with
title 18, United States Code.
(b) Analysis and use of samples. The Director of the Bureau of Prisons or the probation office responsible (as applicable)
shall furnish each DNA sample collected
under subsection (a) to the Director of
the Federal Bureau of Investigation,
who shall carry out a DNA analysis on
each such DNA sample and include the
results in CODIS.
(c) Definitions. In this section:
(1) The term “DNA sample” means a
tissue, fluid or other bodily sample
of an individual on which a DNA
analysis can be carried out.
(2) The term “DNA analysis” means
analysis of the deoxyribonucleic acid
(DNA) identification information in a
bodily sample.
(d) Qualifying Federal offenses.
(1) The offenses that shall be treated
for purposes of this section as
qualifying Federal offenses are the

DNA

INITIATIVE

DNA BAsiCs: PRETRiAl PREPARATioN

following offenses under title 18,
United States Code, as determined
by the Attorney General:
(A) Murder (as described in section
1111 of such title), voluntary
manslaughter (as described in
section 1112 of such title), or
other offense relating to homicide (as described in chapter
51 of such title, sections 1113,
1114, 1116, 1118, 1119, 1120
and 1121).
(B) An offense relating to sexual
abuse (as described in chapter
109A of such title, sections
2241 through 2245), to sexual
exploitation or other abuse
of children (as described in
chapter 110 of such title, sections 2251 through 2252), or to
transportation for illegal sexual
activity (as described in chapter
117 of such title, sections 2421,
2422, 2423 and 2425).
(C) An offense relating to peonage and slavery (as described
in chapter 77 of such title [18
USCS §§ 1581 et seq.]).
(D) Kidnapping (as defined in section 3559(c)(2)(E) of such title).
(E) An offense involving robbery or
burglary (as described in chapter 103 of such title, sections
2111 through 2114, 2116, and
2118 through 2119).
(F) 	 Any violation of section 1153
involving murder, manslaughter,
kidnapping, maiming, a felony
offense relating to sexual abuse
(as described in chapter 109A
[18 USCS §§ 2241 et seq.]),
incest, arson, burglary or
robbery.
(G) Any attempt or conspiracy
to commit any of the above
offenses.

DNA	

INITIATIVE

(2)	� In addition to the offenses
described in paragraph (1), the following offenses shall be treated for
purposes of this section as qualifying Federal offenses, as determined
by the Attorney General:
(A) Any offense listed in section
2332b(g)(5)(B) of title 18, United
States Code.
(B) Any crime of violence (as
defined in section 16 of title 18,
United States Code).
(C) Any attempt or conspiracy
to commit any of the above
offenses.
(e) Regulations.
(1)	� In general. Except as provided in
paragraph (2), this section shall be
carried out under regulations prescribed by the Attorney General.
(2)	� Probation officers. The Director of
the Administrative Office of the
United States Courts shall make
available model procedures for the
activities of probation officers in carrying out this section.
(f)	� Commencement of collection. Collection of DNA samples under subsection
(a) shall, subject to the availability of
appropriations, commence not later
than the date that is 180 days after the
date of the enactment of this Act.
9. 42 U.S.C. § 14135 et seq. 42 U.S.C.
§ 14135; 468 F. Supp. 2d 261, 262.
10. See 42 U.S.C. § 14135e, which provides:
(a) In general. Except as provided in subsection (b), any sample collected under,
or any result of any analysis carried out
under section 2, 3 or 4 [42 U.S.C.
§ 14135, 14135a, or 14135b] may be
used only for a purpose specified in
such section.

83

CHAPTER 7

(b) Permissive uses. A sample or result
described in subsection (a) may be disclosed under the circumstances under
which disclosure of information included
in the Combined DNA Index System is
allowed, as specified in subparagraphs
(A) through (D) of section 210304(b)(3)
of the Violent Crime Control and Law
Enforcement Act of 1994 (42 U.S.C.
§ 14132(b)(3)).
11. Proper authorization required. 42 U.S.C.
§ 14135e(c):
(c) Criminal penalty. A person who
knowingly —
(1)	� Discloses a sample or result
described in subsection (a) in any
manner to any person not authorized to receive it; or
(2)	� Obtains, without authorization, a
sample or result described in subsection (a), shall be fined not more
than $100,000.
12. United States v. Reynard, 2007 U.S. App.
LEXIS 665 (9th Cir. 2007) (DNA collection from
convicted felons constitutional, even if convicted
prior to date of act — retroactivity challenge
rejected); United States v. Hook, 471 F.3d 766
(7th Cir. 2006) (same).The Tenth and Second
Circuits have upheld such searches under
the “special needs” exception to the warrant
requirement. United States v. Kimler, 335 F.3d
1132, 1146 (10th Cir. 2003), cert. denied, 540
U.S. 1083 (mem.); Roe v. Marcotte, 193 F.3d
72 (2d Cir. 1999). Other circuits have relied on
the determination that inmates do not have a
reasonable expectation of privacy against DNA
collections from convicted persons. Ernst v.
Roberts, 379 F.3d 373 (6th Cir. 2004) (upholding
as reasonable a requirement that federal offenders who were on parole, probation or supervised
release submit to compulsory DNA profiling);
Ernst v. Roberts, 379 F.3d 373: Rehearing, en
banc, granted by, Vacated by: Ernst v. Roberts,
2004 U.S. App. LEXIS 24149 (6th Cir. Nov. 17,
2004): Different results reached on rehearing at:
Ernst v. Rising, 427 F.3d 351.

­84

Velasquez v. Woods, 329 F.3d 420, 421 (5th Cir.
2003) (per curiam) (same); Jones v. Murray, 962
F.2d 302, 306-07 (4th Cir. 1992) (“While we do
not accept even this small level of intrusion for
free persons without Fourth Amendment constraint ... the same protections do not hold true
for those lawfully confined to the custody of the
state. As with fingerprinting, therefore, we find
that the Fourth Amendment does not require
an additional finding of individualized suspicion
before blood can be taken from incarcerated
felons for the purpose of identifying them.”).
See generally, Nicholas v. Goord, 2004 U.S. Dist.
LEXIS 11708 (D.N.Y. 2004) (upholding New York
statute against Fourth Amendment challenge and
summarizing case law); Nicholas v. Goord, 2004
U.S. Dist. LEXIS 11708: Subsequent appellate
history contains negative analysis.
Recent state court decisions to the same effect
include State v. O’Hagen, 914 A.2d 267, 270
(N.J. 2007) (“The Act requires all persons convicted of a crime [or found not guilty by reason
of insanity] to give a deoxyribonucleic acid (DNA)
sample. We hold that the Act is constitutional
under both [the United States and New Jersey]
Constitutions.”); Commonwealth v. Derk, 895
A.2d 622, 630 (Pa. Super. Ct. 2006).
13. See In re Calvin S.,150 Cal. App. 4th 443
(Cal. App. 2007) (recognizing juvenile’s stronger
privacy rights but still finding balance of interests
to favor requiring entry of juvenile DNA into databank); United States v. Stewart, 468 F. Supp. 2d
261 (D. Mass. 2007) (finding unconstitutional the
DNA Analysis Backlog Elimination Act of 2000 as
applied to probationer convicted of Social Security fraud); United States v. Stewart, 468 F. Supp.
2d 261: Subsequent appellate history contains
negative analysis.
Vermont v. Watkins (Vt. Dist. Ct. App. 24. 2006)
(No. 6805-2-04) (invalidating on state constitutional grounds the “suspicionless collection and
banking” of DNA samples from all convicted
nonviolent felons); Green v. Berge, 354 F.3d
675, 679-81 (7th Cir. 2004) (Easterbrook, J.,
concurring) (noting, “[f]elons whose terms have
expired” form a different category of individuals
than supervised releasees for the purposes of
a Fourth Amendment inquiry); United States v.
Amerson, 483 F.3d 73, 79 (2d Cir. 2007) (discussing that probationers (at issue in Amerson) have

DNA

INITIATIVE

DNA BAsiCs: PRETRiAl PREPARATioN

a greater expectation of privacy than parolees (at
issue in Samson)); United States v. Kincaide, 379
F.3d 813 (9th Cir. 2004) (en banc) (circuit splits
6-5 in upholding an Act requiring probationers,
parolees and persons on supervised release to
provide DNA for use in a databank, with special
concurrence noting that ruling does not apply to
persons who have fully served supervision period
and paid debt to society); In Re: C.T.L., 722
N.W.2d 484 (Minn. Ct. App. 2006).
14. Fingerprint at scene may not establish probable cause: California: Birt v. Superior Court (1973)
34 Cal. App. 3d 934 (Cal. App. 1973) (defendant’s
fingerprints on a lighter found inside a rented van
used in a robbery deemed insufficient to support
a probable cause finding as the suspect could
have left the lighter in the rental van on some
occasion long before the robbery); New Hampshire: State v. Maya, 493 A.2d 1139, 1144 (N.H.
1985) (fingerprint at scene establishes probable
cause when on item that only the burglar could
have left).
15. Compare United States v. McNeill, 2007 U.S.
Dist. LEXIS 56209, 18-21 (D. Pa. 2007) (cigarette
butt at crime scene plus numerous additional
items of circumstantial evidence proved sufficient for a warrant to obtain defendant’s DNA
profile).
16. As of October 2011, 25 states and the federal government require the collection of DNA
from arrestees.
17. 722 N.W.2d 484, 486 (Minn. Ct. App. 2006).
18. 722 N.W.2d at 491.
19. 722 N.W.2d at 492.
20. Anderson v. Commonwealth, 274 Va. 469,
475 (Va. 2007).
21. 489 U.S. 602, 616 (U.S. 1989).
22. 384 U.S. 757, 766-767 (1966). Schmerber
v. California, 384 U.S. 757: 344 Ill. App. 3d 684,
687; 800 N.E.2d 1227, 1230; 279 Ill. Dec. 644,
647.
23. 489 U.S. at 619 (citations omitted).

DNA

INITIATIVE

24. 392 U.S. 1 (1968) (permitting civilian stops
and, in some instances, frisks on reasonable suspicion, a standard lower than probable cause).
25. None of the foregoing implies that a brief
detention in the field for the purpose of fingerprinting, where there is only reasonable
suspicion not amounting to probable cause,
is necessarily impermissible under the Fourth
Amendment. Hayes v. Florida, 470 U.S. 811, 816
(U.S. 1985). The Hayes court also explained that
removing a person to a police station required
probable cause, “at least where not under judicial supervision,” a caveat implying that a lower
standard might apply when a judge makes the
determination.
26. United States v. Garcia-Ortiz, F. Supp. 2d ,
2005 U.S. Dist. LEXIS 38108 (D.P.R. 12/23/05)
(2005 WL 3533322); United States v. GarciaOrtiz, 2005 U.S. Dist. LEXIS 38108: Subsequent
appellate history contains possible negative
analysis.
U.S. v. Swanson, 155 F. Supp. 2d 992 (C.D. Ill.
7/11/01); In re Shabazz, 200 F. Supp. 2d 578,
583 (D.S.C. 2002); In re Grand Jury Proceedings
Involving Vickers, 38 F. Supp. 2d 159 (D.N.H.
12/4/98); State v. Lee, 964 So. 2d 967 (La. Ct.
App. 2007); State v. Rodriguez, 240, 921 P.2d
643, 650 (Ariz. 1996) (based on Arizona Nontestimonial Order [NTO] statute); State v. Rodriguez,
240, 921 P.2d 643.
State v. Lee, 964 So. 2d 967 (La. Ct. App. 2007);
In re Nontestimonial Identification Order Directed
to R.H., 762 A.2d 1239 (Vt. 2000).
27. Schmerber v. California, 384 U.S. 757 (1966).
28. Schmerber, 384 U.S. at 757, 769-770.
29. Hayes v. Florida, 470 U.S. 811, 816 (U.S.
1985) at 813. This rule of exclusion has not
been applied in immigration arrest cases if the
fingerprints were taken for deportation proceeding purposes and not for an “unanticipated
and unforeseen criminal prosecution[.]” United
States v. Oscar-Torres, 2007 U.S. App. LEXIS
25988 (4th Cir. 2007). This limited exception to
the suppression doctrine should have no applicability in the typical criminal case.

85

CHAPTER 7

30. American Bar Association (ABA) Standards
for DNA Evidence, Standard 2.2(b)(i)(C), www.
abanet.org/crimjust/standards/dnaevidence.
html#2.2. The ABA has created Criminal Justice Standards on DNA Evidence. Regarding
the collection of DNA from a suspect, Standard
2.2 requires a search warrant or judicial order
to collect DNA over a person’s objection. The
standard further cautions that, “except in exigent
circumstances,” this should not occur until after
a hearing with counsel. The state must establish
reasonable suspicion or probable cause, depending on the collection method, and the state
must further establish “the sample will assist in
determining whether the person committed the
crime.”

34. Jones v. State, 343 So. 2d 921, 923 

(Fla. 3rd DCA 1977) (internal quotations omitted).
�

Practically speaking, the state may seek to obtain
your client’s DNA profile to compare the profile
with any DNA that may be found on a certain
piece of evidence, such as a gun. Without knowing if there is DNA on the gun, the state cannot
possibly assure the court that having the defendant’s sample will assist in determining whether
he or she possessed the gun. As such, defense
counsel should strenuously object to the taking of their client’s DNA profile without proof
that the state has an item of evidence that has
already yielded an unidentified DNA profile.

39. 416 A.2d 1209 (Conn. 1979).
�

31. Schmerber v. California, 384 U.S. at 757, 770.

43. United States v. Edwards, 415 U.S. 800, 802 

(U.S. 1974).
�

32. See, e.g., United States v. McNeill, 2007 U.S.
Dist. LEXIS 56209, 18-21 (D. Pa. 2007) (warrant
for DNA sample from McNeill approved after his
DNA profile was found on a cigarette butt left at
the robbery scene; DNA warrant was obtained
for confirmatory testing and match).
33. See, e.g., United States v. Wright, 215 F.3d
1020, 1026 (9th Cir. 2000) (blood trail from
bank robber who was shot at crime scene is a
sufficient predicate for DNA testing of Wright,
once evidence was developed identifying him
as suspect); People v. Phillips, 336 Ill. App. 3d
1033, 1035-1036 (Ill. App. Ct. 2003) (“One would
expect that when oral and vaginal sexual assaults
are alleged, hair, semen, and/or blood may be
present, thereby establishing a sufficient nexus
between the assault and the need for such evidence.”).

­86

35. 641 N.E.2d 1328 (Mass. 1994).
�
36. Id. at 1331 (internal citation omitted).
�
37. Id. (citing Warden Md. Penitentiary v. 

Hayden, 387 U.S. 294, 307, 87 S. Ct. 1642, 1650 

(1967)). See also Pittman v. United States, 375 

A.2d 16, 19 (D.C. 1977) (Tangible objects — like 

the samples sought from Mr. Smith — must be 

relevant in some way “either independently or as 

corroborative of other evidence.”). 

38. Id. at 1332.
�

40. Id. at 1211 (emphasis added).
�
41. See, e.g., State v. Hardaway, 36 P.3d 900, 

915 (Mont. 2001) (disallowing warrantless test 

of blood on the defendant’s hand where police 

knew it was the defendant’s and not a crime victim’s).
�
42. Cupp v. Murphy, 412 U.S. 291, 296 (U.S. 

1973).
�

44. Washington v. State, 922 So. 2d 145, 169 

(Ala. Crim. App. 2005); Commonwealth v. Houghton, 2007 Mass. Super. LEXIS 390 (Mass. Super. 

Ct. 2007).
�
45. Cf. State v. Madplume, 2005 Mont. Dist. 

LEXIS 1510 (Mont. Dist. 2005) (finding no exigency where defendant “was in police custody and 

under arrest in a tribal jail cell with no sink, toilet 

or water and was under the full control of law 

enforcement”); 2005 Mont. Dist. LEXIS 1510.
�
46. Schneckloth v. Bustamonte, 412 U.S. 218 

(U.S. 1973).
�
47. Florida v. Jimeno, 500 U.S. 248, 251 (U.S. 

1991) (“The scope of a search is generally 

defined by its expressed object.”).
�

DNA

INITIATIVE

DNA BAsiCs: PRETRiAl PREPARATioN

48. Some courts have held that language limiting consent to a specific use bars all others. See,
e.g., State v. Gerace, 437 S.E.2d 862, 863 (Ga.
Ct. App. 1993) (consent to alcohol and drug testing in blood did not extend to DNA testing);
State v. Binner, 886 P.2d 1056 (Ore. Ct. App.
1994) (consent for alcohol testing of blood and
refusal to allow drug testing of blood must be
honored).
49. Cf. United States v. Yang, 478 F.3d 832, 835
(7th Cir. 2007) (relinquishing notebook to police
for fingerprint analysis allowed police to read
notebook):
Rather, he voluntarily allowed Officer Schneider to take the notebooks in their entirety
to the police station and hold them for several days. He placed no limitations on access
to the notebooks. He did not separate the
notebook covers and keep the written contents to himself. He did not request that the
officers perform the fingerprint analysis in
his presence. He did not close or secure the
contents of the notebooks in anyway so that
only the covers could be accessed.
50. See, e.g., Wyche v. State, 906 So. 2d 1142,
1143-1149 (Fla. 1st DCA 2005).
51. See Walker, S., “Police DNA ‘Sweeps’
Extremely Unproductive: A National Survey of
Police DNA ‘Sweeps,’” P oLice P r ofe s s ionALis M i nitiAtive , Department of Criminal Justice, University
of Nebraska (2004).
52. State v. Notti, 71 P.3d 1233, 1237-1238
(Mont. 2003).
53. Pharr v. Commonwealth, 646 S.E.2d 453,
457 (Va. Ct. App. 2007). See also State v. Glynn,
166 P.3d 1075, 1078 (Kan. Ct. App. 2007)
(“We hold there is no constitutional violation or
infringement of any rights of privacy when the
police use a DNA profile lawfully obtained in one
case to investigate and charge the DNA donor in
a subsequent and different case or cases.”).
54. For example, in one Michigan case, the
police “requested” that all African-American men
in a particular neighborhood “volunteer” DNA
samples and were warned that refusal would
cause grounds for suspicion. Some who refused
were, in fact, subject to later search warrants.

DNA

INITIATIVE

After a class action lawsuit, police agreed to
destroy the collected DNA. See “DNA Dragnet
Police Seek DNA Samples From the Public to
Catch the Guilty,” available at www.cbsnews.com/
stories/2004/09/10/60minutes/main642684.shtml;
Peterson, R.S., “Note: DNA Databases: When
Fear Goes Too Far,” 37 A M e r . c r iM . L. r e v . 1219,
1224, 1227 (2000) (citing Willing, R., “Privacy
Issue Is the Catch for Police DNA ‘Dragnets,’”
USA t odAy (Sept.16, 1998); Hansen, M., “DNA
Dragnet,” ABA J. (May 2004) 38-43). A similar
situation occurred in Louisiana, and citizens
were allegedly told that failure to cooperate
would result in public identification as a suspect.
O’Brien, K., “Men Seek Return of DNA From
Serial Killer Search: Some Claim Police Bullied
Them For Swabs,” t iM e s -P icAyune (Dec. 28,
2003); Sayre, A., “Tool of DNA Offers Potential
for Abuse,” t he B Aton r ouge A dvocAte (Dec.
22, 2003); “Men Targeted by ‘DNA Dragnet’
Demand Return, Destruction of Samples,” t he
n e w s tAndAr d (Nov. 9, 2004).
55. The police also searched the DNA of approximately 1,300 other individuals in this case. See
“Judge Orders Removal of Wichita Man’s DNA
Sample from Database,” AP n e w s w ir e (March 21,
2005).
56. Id.
57. California v. Greenwood, 486 U.S. 35, 40-41
(U.S. 1988) (internal quotation and citation omitted):
[H]aving deposited their garbage in an area
particularly suited for public inspection and,
in a manner of speaking, public consumption,
for the express purpose of having strangers
take it, respondents could have had no reasonable expectation of privacy in the inculpatory items that they discarded.
58. See, e.g., Litchfield v. State, 824 N.E.2d 356,
363 (Ind. 2005); Henderson, “Learning From All
Fifty States: How to Apply the Fourth Amendment and Its State Analogs to Protect Third Party
Information From Unreasonable Search,” 55
c AthoLic u. L. r e v . 373 (Winter 2006).
59. Commonwealth v. Cabral, 866 N.E.2d 429,
433-435 (Mass. App. Ct. 2007).
60. State v. Athan, 158 P.3d 27, 33 (Wash. 2007).

87

CHAPTER 7

61. Hudson v. State, 205 S.W.3d 600, 604
(Tex. App. 2006).
62. State v. Reed, 641 S.E.2d 320, 322-323 (N.C.
Ct. App. 2007).
63. Daubert v. Merrell Dow Pharmaceuticals,
509 U.S. 579, 113 S. Ct. 2786, 125 L.Ed.2d 469
(1993).

69. See, e.g., Murray v. State, 838 So. 2d 1073,
1077-1082 (Fla. 2002).

64. Frye v. United States, 54 App. D.C. 46, 293
F. 1013, 1014 (D.C. Cir. 1923). Superseded by
statute as stated in: Smith v. GE, 2004 U.S. Dist.
LEXIS 7011 (D. Mass. Apr. 23, 2004) 2004 U.S.
Dist. LEXIS 7011.

70. See, e.g., United States v. Morrow, 374 F.
Supp. 2d 42, 50 (D.D.C. 2005).

65. See, e.g., Johnson v. State, 264 Ga. 456, 448
S.E.2d 177, 179 (Ga. 1994) (quoting Caldwell v.
State, 260 Ga. 278, 286-287(1)(b) (1990)) (admissibility of DNA evidence turns on the trial court’s
determination of “whether the general scientific
principles and techniques involved in [DNA testing] are valid and capable of producing reliable
results, [and] also whether [the DNA tester
himself] substantially performed the scientific
procedures in an acceptable manner.”); Spencer
v. Commonwealth, 240 Va. 78, 393 S.E.2d 609
(1990) (“The court must make a threshold finding of fact with respect to the reliability of the
scientific method offered (i) unless it is of a kind
so familiar and accepted as to require no foundation to establish the fundamental reliability of the
system; or (ii) unless it is so unreliable that the
considerations requiring its exclusion have ripened into rules of law; or (iii) unless its admission
is regulated by statute.”).

72. United States v. Morrow, 374 F. Supp. 2d 51,
66 (D.D.C. 2005).

66. See, e.g., United States v. Morrow, 374 F.
Supp. 2d 51, 62 (D.D.C. 2005) (collecting cases
under Daubert); People v. Shreck, 22 P.3d 68, 80
(Colo. 2001) (collecting cases under Frye).
67. See, e.g., United States v. Beverly, 369 F.3d
516, 529 (6th Cir. 2004); Magaletti v. State, 847
So. 2d 523, 528 (Fla. 2nd DCA 2003) (collecting cases); State v. Underwood, 134 N.C. App.
533, 518 S.E.2d 231 (N.C. Ct. App. 1999); State
v. Scott, 33 S.W.3d 746 (Tenn. 2000); State v.
Council, 335 S.C. 1, 515 S.E.2d 508 (S.C. 1999);
People v. Klinger, 185 Misc. 2d 574, 713 N.Y.S.
2d 823 (N.Y. Crim. Ct. 2000); Williams v. State,
342 Md. 724, 679 A.2d 1106 (Md. 1996).

­88

68. See United States v. Adams, 189 Fed. App.
120, 124 (3d Cir. 2006); State v. Russell, Wash.
App. LEXIS 3041 (Wash. Ct. App. 2007) (holding
that Frye hearing is unnecessary, as Y-STR typing
is “merely one specific type of STR DNA testing”).

71. United States v. Morrow, 374 F. Supp. 2d 51,
65 (D.D.C. 2005) (collecting cases).

73. United States v. Graves, 465 F. Supp. 2d 450,
459 (D. Pa. 2006):
[E]ven with appropriate safeguards, the minimal probative value of the umbrella DNA
evidence — in which half of the relevant
population cannot be excluded as a contributor to the DNA sample — is substantially
outweighed by the danger of unfair prejudice and confusion of the issues. Thus, the
sneaker DNA evidence is admissible and the
umbrella DNA evidence is not admissible.
74. See, e.g., United States v. Sallins, 993 F.2d
344, 346 (3d Cir. 1993) (restricting use of evidence explaining “background” of police investigation where “the need for such evidence is
slight”).
75. United States v. Williams, 113 F.3d 243, 247
n.3 (D.C. Cir. 1997) (“evidence of a prior arrest,
without more, would not have been admissible
as it would not tend to prove predisposition, but
at most general criminal propensity”).
76. See generally, Old Chief v. United States,
117 S. Ct. 644 (U.S. 1997).
77. 541 U.S. 36 (U.S. 2004).
78. Citing to authority from the time of the adoption of the Bill of Rights, the Court noted, “Most
of the hearsay exceptions covered statements
that by their nature were not testimonial — for

DNA

INITIATIVE

DNA BAsiCs: PRETRiAl PREPARATioN

example, business records or statements in furtherance of a conspiracy.” Crawford v. Washington, 541 U.S. 36, 56 (U.S. 2004).
79. See, e.g., Rollins v. State, 897 A.2d 821, 833
(Md. 2006) (collecting cases).
80. See, e.g., Roberts v. United States, 916 A.2d
922, 938 (D.C. 2007):
[T]he conclusions of FBI laboratory scientists
— the serologist, the PCR/STR technician
and the examiner — admitted as substantive evidence at trial are “testimonial” under
Crawford [and] thus subject to the requirements of cross-examination and declarant
unavailability confirmed by that decision.
81. See, e.g., State v. Crager, 2007 Ohio LEXIS
3355 (Ohio 2007); People v. Geier, 161 P.3d 104,
138 (Cal. 2007).
82. 129 S. Ct. 2527 (2009).
83. Id. at 30.
84. Id. at 25-26.
85. Id. at 30 (internal quotation omitted).
86. Also unanswered by this decision is whether
the right of confrontation is violated when one
analyst testifies to results and to his confirmation or verification by another lab employee. This
remains an open issue in confrontation analysis.
87. Id. at 37.
88. This issue may be decided by the U.S.
Supreme Court in a review of Briscoe v. Va.,
2009 U.S. LEXIS 4947 (U.S., June 29, 2009).
89. See, e.g., United States v. Morrow, 374 F.
Supp. 2d 51, 65 (D.D.C. 2005) (“the particular
DNA matches identified by Defendants Morrow
and Palmer do not show a significant statistical
probability that they contributed to those samples; however, they do show that the defendants
cannot be excluded as contributors [and thus]
the DNA evidence remains probative”); United
States v. Graves, 465 F. Supp. 2d 450, 458 (E.D.
Pa. 2006) (same; collecting cases).

DNA

INITIATIVE

90. In Morrow (note 89, supra), the court held
that “even DNA evidence with relatively low statistical significance may be admitted as probative
evidence, provided that certain safeguards are
afforded.” 374 F. Supp. 2d at 68.
91. In Graves (note 89, supra), the District Court
ruled that crime scene DNA on an umbrella was
inadmissible because of the risk of undue prejudice and confusion:
[T]he minimal probative value of the umbrella
DNA evidence — in which half of the relevant population cannot be excluded as a contributor to the DNA sample — is substantially
outweighed by the danger of unfair prejudice
and confusion of the issues.
92. United States v. Graves, 465 F. Supp. 2d 450,
459 (E.D. Pa. 2006):
In the fall of 2005, Arizona ... compared the
DNA profiles of each of the 65,493 persons
in its database against each other. From this
comparison, Arizona DPS reported some
remarkable findings: its database had 122
pairs of people who matched at 9 out of the
13 loci [and] 20 that matched at 10 loci ... .
Ungvarsky, E. “What Does One in a Trillion
Mean?” 20(1) g e ne w Atch 10-14 (January/
February 2007), http://www.wisspd.org/htm/
ATPracGuides/Training/ProgMaterials/Conf2011/
CDNAE/11.pdf. See also Chapter 9, Section 7.
93. The debate is aptly summarized in decisional
law (see United States v. Jenkins, 887 A.2d
1013, 1025 (D.C. 2005); People v. Nelson, 43
Cal. 4th 1242, 185 P.3d 49 (2008)) and in newspaper accounts (“Debate on Analyzing ‘Cold Hit’
DNA Matches Swirls in Case Before California
Supreme Court,” L os A nge Le s t iM e s (May 9,
2008)).
94. “DNA of Criminals’ Kin Cited in Solving
Cases,” w As hington P os t , A-10 (May 12, 2006)
(quoting estimates by Dr. Frederick Bieber).
95. See note: “Less Privacy Please, We’re British: Investigating Crime with DNA in the U.K. and
the U.S.,” 31 h As tings i nt ’ L & c oM P . L. r e v . 487
(Winter 2008).

89

CHAPTER 7

96. American Prosecutors Research Institute,
“Catching Criminals by Investigating Profiles with
Allelic Similarities,” 10 s iLe nt w itne s s , 2 (2006)
(“Until recently, the FBI did not release the personal information of partial matches”), www.
ndaa.org/publications/newsletters/silent_witness_volume_10_number_2_2006.html.

100. See, e.g., Minutes of the Commonwealth of
Virginia Scientific Advisory Committee
on Familial DNA (May 8, 2007),
www.dfs.virginia.gov/about/minutes/
saCommittee/20070508.pdf. In March 2008, the
FBI sponsored a two-day conference on familial
DNA issues.

97. “Brown Unveils DNA Technique to Crack
Unsolved Crimes,” o ffice o f t he A ttor ne y g e n e r AL (April 25, 2008), http://ag.ca.gov/newsalerts/
release.php?id=1548&.

101. See, e.g., Epstein, “‘Genetic Surveillance’
— The Bogeyman Response to Familial DNA
Investigations,” s ociAL s cie nce r e s e Ar ch n e tw or k
(May 5, 2008), http://papers.ssrn.com/sol3/
papers.cfm?abstract_id=1129306.

98. Senate Bill 211 (2008), § 2-506(D), http://
mlis.state.md.us/2008rs/bills/sb/sb0211e.pdf.
99. A Not So Perfect Match, “60 Minutes,” aired
April 1, 2007, www.cbsnews.com/
stories/2007/03/23/60minutes/main2600721.
shtml?source=search_story.

­90

102. Bieber, Brenner, and Lazer, “Finding Criminals Through DNA of Their Relatives,” 312 s cie nce , 5778 (June 2006), 1315-1316.

DNA

INITIATIVE

CHAPTER 8

DNA­Basics:­Trial­Issues­
Section­1:­Getting­Ready­for­Trial
Finalize­defense­theory
As defense counsel prepares for trial, it is critical
to finalize the defense theory with respect to the
DNA evidence in the case. At the outset, counsel
has two options:
■■

The DNA profiles match, but there is an
innocent explanation for it.

■■

The client is not the source of the DNA.

If the DNA evidence appears to be rock solid and
leaves counsel with no viable angle from which
to challenge the evidence itself — for example,
if it is not a mixture of body fluids from two or
more individuals, there is ample biological material, there are no claims of allelic drop-out, the
statistic is in the quadrillions, there is no close
relative who might share the profile, and there
is no other reasonable explanation — defense
counsel may have to concede that the DNA
belongs to the client but then challenge the link
that the government seeks to establish between
the DNA and the crime.
Defense counsel might challenge the time or
manner in which the DNA was deposited. Perhaps the defendant had a legitimate reason to be
at the crime scene before the crime happened,
and his DNA could be there for a noninculpatory reason. In this type of case, counsel could
concede the validity of DNA science (because it
reliably supports a fact consistent with defense
theory) but then contrast it with other forensic
evidence that may have a poorly established
empirical foundation.
Alternatively, perhaps the location of the DNA
or the cellular type from which it was extracted
— for example, skin cells rather than blood —
is inconsistent with the government theory

DNA

INITIATIVE

of events or the manner by which the DNA is
alleged to have arrived on the scene. Perhaps
the defendant was never at the crime scene,
and his DNA was transferred from someone or
something to the crime scene or to a piece of
evidence after it was collected from the scene.
Given evidence in support, counsel might also
choose to argue that the evidence was contaminated at the crime lab when the defendant’s
reference sample was analyzed on the same day
as the crime scene evidence. Perhaps the defendant’s DNA was planted. These latter lines of
argument — contamination or a plant — should
be approached with caution.
On the other hand, if the case involves a DNA
mixture to which the client allegedly contributed, or if it involves a degraded DNA sample,
the defense theory may be that the DNA analyst made a series of subjective judgment calls
throughout the analysis. This is the phenomenon
known as observer bias, contextual bias, confirmation bias, ascertainment bias or expectation
bias, in which an individual unconsciously interprets ambiguous evidence to fit a preconceived
notion (in this case, that law enforcement arrested the right person).
In a “cold hit” case, the defense theory may
be that perhaps the statistic used to represent
the probability of a random match dramatically
overestimates the significance of finding a match
when it was obtained by searching a large database, or ignores the fact that the match may
have been coincidental. In the case of Y-STR or
mtDNA, the defense theory may be that perhaps
the population database used as a basis for the
statistic is not a proper sampling of the relevant
population and thus cannot serve as a reliable
basis for the statistic that purports to describe
the frequency with which the profile in question
is expected to occur in the population.

­91

CHAPTER 8

Regardless of the theory that counsel selects to
challenge the DNA evidence, it should be “beta
tested,” using both DNA specialists and nonDNA specialists to ensure that the theory comes
through clearly and understandably despite the
complexity of the evidence. For additional strategy information, see Chapter 10, Section 1.

Section­2:­Trial­Advocacy
Although all criminal trials require careful adherence to the principles of trial advocacy, special
care is needed in cases with forensic DNA evidence. Jurors may not understand the limitations
of DNA evidence regarding the risk of an unreliable match and what DNA does not prove in a
particular case.
Because of these concerns, counsel must develop a consistent theme and theory — in consultation with an expert in forensic DNA science and
trials — that will inform the pretrial motions
practice, jury selection, opening statements,
witness examination, closing arguments and
jury instruction requests. Given that many jurors
today are more receptive to receiving information
visually rather than by testimony alone, counsel
must also assess whether a PowerPoint® or
other presentation will enhance the jury’s comprehension of the defense theory. As part of this
overarching strategy, counsel will have to decide
how to address the DNA evidence — to acknowledge it briefly, embrace it as part of the defense
theory, or attack it.

Section­3:­DNA­and­the­Jury
Some lawyers and experts may forget how to
influence the people they are trying to persuade.
Moreover, some judges may ignore the people
whose responsibility it is to actually decide the
case — the jurors. One question that must be
addressed is whether jurors really understand what
lawyers and experts are trying to communicate.1
The issue of juror comprehension of forensic
DNA evidence transcends the adversary roles in
the courtroom. Sometimes, DNA will favor the
defendant; at other times, it will be the prosecution’s key tool in seeking a conviction. Regardless of which party relies on the DNA evidence,
the tools for juror comprehension remain the
same.

­92

A judge has the authority to ensure that evidence
is presented in a comprehensible manner. This
derives primarily from Rules 611 and 614 of the
Federal Rules of Evidence (FRE), and their counterparts at the state level. In forensic DNA cases,
processes that have been suggested or applied
include the following:
■■

Juror note-taking.

■■

Multipurpose notebooks for jurors (with
glossaries, witness names and photos,
pre-admitted exhibits, etc.).

■■

Written preliminary instructions, with copies
to all jurors.

■■

Pretrial tutorials for jurors and judges.

■■

Funding for representatives of indigent persons to obtain a teaching expert for complex
scientific evidence.

■■

Copies of an expert’s PowerPoint® slides
to jurors for review during testimony.

■■

Exhibit management and indexing.

■■

Introduction of court experts.

■■

Sequential expert testimony: In a case with
both prosecution and defense expert witnesses, a judge may have the defense experts testify immediately after the prosecution experts
to allow the jury to digest all expert opinion
and reasoning at one time.

■■

A decision tree to help jurors comprehend the
steps necessary to reach a conclusion based
on scientific evidence.

■■

Language or images that convey probabilities
and other complex issues.2

■■

Juror questions submitted to witnesses (in
particular, scientific witnesses).

■■

Juror discussions of evidence during trial
breaks.

■■

Interim commentaries or summaries by
attorneys in lengthy trials.

■■

Judicial intervention when expert testimony
is incomprehensible.

■■

Reopening or reclosing upon impasse (if jurors
need help on a particular issue).

■■

Copies of written final instructions to all jurors.

■■

Jury instructions in nontechnical language to
facilitate assessment of expert testimony.

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

■■

Completion of responses to juror questions
and requests during deliberations, including alternatives to responding, “Rely on the
instructions previously given.”

This list does not endorse these practices or
suggest that they are fair and appropriate in
particular cases. Rather, the list highlights the
types of presentation innovations that have been
tested and implemented because of the advent
of forensic DNA evidence. In any case, proposed
techniques must be assessed to determine
whether they diminish the prosecution’s burden
of proof or unduly emphasize the forensic evidence. Techniques must also comply with jurisdictional law and due process requirements.

Section­4:­Jury­Selection
The term jury selection is actually a misnomer.
Lawyers do not select jurors directly; instead,
they reject those who appear antagonistic to
their side. Jury selection, when conducted
properly, may serve multiple purposes:
■■

Educating prospective jurors.

■■

Humanizing the defendant.

■■

Identifying jurors who might favor one side
(or, at least, might be neutral).

■■

Highlighting those antagonistic to one side
and then developing grounds for a challenge
for cause.

■■

Developing potential issues for appeal.

Whether each goal can be achieved may depend
on whether the judge conducts the process
entirely or permits attorney questioning, and how
sophisticated is the attorney’s understanding of
the law and practice of voir dire.
Counsel must be familiar with the governing
principles of voir dire — in particular, the constitutional mandate that jurors be impartial,3 and
the ban on race4 and gender5 as factors in juror
rejection or selection. Beyond that, counsel must
develop the skills required for voir dire.
The first of these required skills is in the shaping
of questions. Telling jurors what the law is, and
then asking them about their ability to follow the
law, is a useless practice. Prospective jurors are
likely to give the response, “Of course I can and

DNA

INITIATIVE

will follow the law.” Open-ended questions —
asking the juror what he or she thinks — are
much more likely to reveal prejudices, biases or
fixed opinions. Questions such as “What do you
think about DNA in criminal cases?” or “Do you
think police labs ever make errors when they
collect and analyze DNA?” are much more likely
to get an honest and accurate response than
“Jurors must be open to all possibilities, such as
lab error. You can do that, can’t you?”
Closed-ended (leading) questions are best used
when developing a challenge for cause. At this
point, subtly and with control, the lawyer should
try to direct the prospective juror in a way that he
or she expresses strong allegiance to a partiality
or other impairment.
Important questions to ask jurors in a DNA-based
prosecution may include:
■■

What do you know about DNA?

■■

Do you have a science background?

■■

Do you have a strong belief that if a person’s
DNA is allegedly found at a crime scene, he
or she must be guilty? Why or why not?

■■

Do you watch television shows about police
investigation, such as CSI-type programs? If
so, what do they make you think about DNA
and crime solving?

■■

Are you aware that labs can make mistakes in
handling and testing DNA?

Questions about juror trust in law enforcement
officers and law enforcement laboratories are
also critical, as jurors who unquestionably accept
police testimony will not be open to challenges
regarding evidence collection or lab practices.
Some questions that might help explore these
issues include the following:
■■

Tell me the biggest mistake you (or someone
you know) ever made at work.

■■

Did anyone find out about the mistake?

■■

How did you handle it?

■■

Do you wish you had handled it differently?

■■

If two people testified about an event, one a
police officer and one a civilian, and they had
different versions, would you be more likely to
believe the police officer?

­
93

CHAPTER 8

■■

Some people believe that if there is DNA
evidence, it does not matter what the other
evidence does or does not show. How do you
feel about that?

Some of these questions may also be appropriate in a case where DNA evidence would be
expected but was not found. In such cases, juror
expectations may support an argument that guilt
has not been proven beyond a reasonable doubt.
Ultimately, the defense theory and counsel’s
understanding of how many questions the judge
will tolerate must inform the selection of questions. Experienced lawyers know that if a judge
allots limited time to the jury selection process,
more latitude will be given when lawyers focus
on relevant questions quickly.
In a complex or high-profile case, judges may
be amenable to the use of juror questionnaires.
Questionnaires are useful screening tools before
in-court questioning takes place. Judges can
pose the types of questions set forth above, and
a quick review of the written answers can determine whether and what additional questioning is
worthwhile.

Section­5:­Opening­Statement
Defense counsel will almost always need to
address the DNA evidence in the opening
statement.
There are three explanations for DNA evidence:
(1) the DNA profiles match and originated from
the same person, (2) there was contamination or
error, or (3) the DNA profiles match by chance.
The opening statement is an opportunity to
explain to the jury that the DNA evidence:

­94

■■

Is not relevant (e.g., the defendant lives at the
location, or there was an innocent transfer of
DNA from an item to the evidence).

■■

Is not important (e.g., there was consent in
a rape case).

■■

Could be interpreted differently (e.g., a DNA
mixture profile in a gang rape case where neither the defendant nor 50 percent of the general population could be excluded as potential
contributors).

Using technical terms such as loci or electropherogram in an opening statement is not recommended. If the DNA issue is easy for the average
person to comprehend, use simple language that
a high school student could understand — even
if counsel can use the technical terms with ease.
If the DNA issue is complicated, find a way to
make it easy by using pictures, simple charts,
analogies or examples.
This is not the time to be embarrassed to call and
ask other attorneys for examples of simple ways
to explain DNA concepts. Just as colleagues
have stories to illustrate circumstantial evidence
and reasonable doubt, more and more attorneys
are developing stories to illustrate DNA concepts. This is particularly true in public defender
offices in major cities. Resources may also be
available through national defense attorney associations, such as NACDL and NLADA. An experienced expert witness will be able to help explain
the DNA evidence to the jury in simple terms.

Section­6:­Witness­Preparation
If the defense is considering calling an expert
witness at trial, counsel must thoroughly prepare
beforehand. Witness preparation begins with the
informed selection of a qualified expert. Throughout the investigative stages of the case, defense
counsel must regularly consult with the expert to
determine what issues will need to be brought
before the jury. In addition, the expert may be
able to assist counsel in determining how best to
present the evidence, particularly when exhibits
are used.
For a detailed explanation of the witness preparation process in a forensic DNA case, see Chapter
4, Section 1.

Section­7:­Objections­During­the­
State’s­Direct­Examination­of­a­­
DNA­Expert
A well-prepared prosecution expert will know not
to stray from the facts or go beyond his or her
expertise. When confronted with such a witness,
defense counsel may conclude that objections
will be counterproductive — they may alienate
jurors and prolong the witness’s testimony with

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

what may be terribly damaging evidence. Thus,
a strategy of “Don’t object” or “Get the witness
off the stand quickly” may be best.
Nonetheless, counsel must be alert to areas
where objections are appropriate and potentially
beneficial to the defense. These are areas in
which:
■■

The expert has testified beyond his or her
qualifications (e.g., when someone with no
training in statistics offers probability data).

■■

There is no foundation for a particular claim,
or when the answer assumes facts not in
evidence.

■■

The expert’s explanation is misleading.

The last category is one in which defense
counsel may prefer not to object if, in fact, the
defense has a qualified expert who can explain
to jurors how the prosecution witness erred.
Defense counsel must be familiar with the applicable evidentiary rules governing expert testimony, particularly the rules that limit what an expert
may rely on, and what reliable evidence may be
repeated in the courtroom.6
Similarly, counsel must consider whether confrontation guarantees a successful result —
currently a hotly debated topic. Hearsay rules
limit testimony to one expert witness for each
result or analysis that is prepared by lab personnel other than the expert witness.7

Section­8:­Taking­Juror­Questions­
During­Testimony­(If­Allowed)
In many (but not all) jurisdictions, trial courts are
given the discretion, or are mandated by court
rules, to allow jurors to ask questions of the witnesses during the trial.8 Because of the “CSI
effect,” many jurors are particularly interested in
forensic science issues and expert witnesses.
Several studies have shown increased juror satisfaction and attentiveness in jurisdictions where
jurors are allowed to ask questions.9
In these jurisdictions, jurors can submit written
questions to all trial witnesses following the
completion of counsel’s questioning of each witness. Trial judges must instruct jurors of their

DNA

INITIATIVE

right to ask questions and the procedures to be
followed.
Typical court rules provide that, after the trial
judge asks whether the jurors have any
questions for the witness, the jurors’ written
questions — unsigned — are handed to a
member of the courtroom staff. After the judge
reviews the questions, defense and prosecution counsel approach the bench, review the
questions, and make any objections outside
the hearing of the jury. The court will determine
the acceptability of each question asked and, if
deemed appropriate, typically will ask the witness the juror’s question. Both sides are then
permitted to ask follow-up questions, limited to
the answer given by the witness.
If the court sustains an objection to the question, the question will not be asked. Jurors are
instructed that their questions will be treated the
same as questions asked by counsel, subject to
objections, and that the jury should not attach
any significance to counsel not asking a particular
question.

Section­9:­Effective­­
Cross-Examination­of­a­DNA­Expert
There is no prepackaged script for cross-examining a DNA expert. The substance and tone of the
cross-examination will depend on the facts, the
defense theory of events, the expert witness and
other case-specific considerations. At the outset,
defense counsel should determine exactly what
they want to communicate to the jury about the
DNA evidence. How can the defense make the
DNA expert a defense expert and make the DNA
evidence support the defense theory of events,
while contradicting the prosecution’s theory (or
at least showing that the DNA provides no evidence in support of the prosecution’s theory)?
Broadly speaking, there are two directions that
defense counsel can go in cross-examining a
government DNA expert. One direction is adversarial, by which counsel seeks to undermine
the expert’s testimony and ultimate conclusion.
The other direction is nonadversarial; counsel
does not dispute the analyst’s central premise
but, rather, tries to turn the expert’s testimony
into evidence that actually supports the defense
theory.

­
95

CHAPTER 8

The­adversarial­cross-examination
FOR CASES INVOLVING DNA TRANSFER:
Q.	� Are you familiar with the concept of DNA
transfer?
A.	� Yes.

FOR CASES INVOLVING DNA TRANSFER OF
A PRIMARY WEARER OR MAJOR PROFILE:

Q.	� Is it true that DNA can transfer from a
person to an object?
A.	� Yes.

Q.	� Isn’t it true that people sometimes transfer
DNA onto clothes when they wear them?
A.	� Yes.

Q.	� For example, if a person bleeds onto the
floor, his DNA transfers from inside his body
onto the floor?
A.	� Yes.

Q.	� You would expect to find my DNA on the collar of my shirt, for example; is that correct?
A.	� Yes.

Q.	� This is called primary transfer?
A.	� Yes.
Q.	� If someone stepped into the blood on the
floor, we’d expect some of the blood to
transfer from the floor onto the shoes?
A.	� Yes.
Q.	� That’s an example of secondary transfer?
A.	� Yes.
Q.	� If the person then walked across the room,
some of that blood would transfer from the
bottom of his shoe onto the floor with each
step?
A.	� Yes.

Q.	� This is called wearer DNA?
A.	� Yes.
Q.	� If two people wore the same shirt, you could
find two DNA profiles on the shirt; is that
correct?
A.	� Yes.
Q.	� Isn’t it also true that some people leave more
DNA behind than others?
A.	� Yes.
Q.	� Is that because people shed their skin cells
that contain DNA at different rates?
A.	� Yes.

Q.	� That’s called tertiary transfer?
A.	� Yes.

Q.	� The major profile refers to the contributor
who has more DNA than the other person in
a mixed sample?
A.	� Yes.

Q.	� Because of DNA transfer, you can get blood
into a room in which the bleeding person
was never present?
A.	� Yes.

Q.	� Isn’t it true that the major DNA profile
doesn’t tell you who wore the item of
clothing last?
A.	� Yes, that’s true.

Q.	� This is true for other DNA sources as well?
A.	� Yes.

Q.	� Isn’t it true that the major DNA profile
doesn’t tell you who wore the item of clothing most often?
A.	� That’s correct, it doesn’t.

Q.	� For example, skin cells can transfer from my
hands to the counsel table?
A.	� Yes.
Q.	� If you came by the table and put your hands
on it, some of my DNA could transfer onto
your hands?
A.	� Yes.

­96

Q.	� If you then went to the door and opened
it, you could leave some of my DNA on the
door handle?
A.	� Yes.

Q.	� So, what your DNA testing tells us is that a
person with that profile cannot be excluded
as having had contact with that item at some
point in time; is that correct?
A.	� Yes.

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

Q.	� And it doesn’t tell us when that happened,
where it happened or how it happened; isn’t
that true?
A.	� Yes.
FOR CASES INVOLVING THE INNOCENT
DEPOSIT OF DNA:
Q.	� The DNA test results can’t tell when the
DNA was left; is that correct?
A.	� Correct.
Q.	� The DNA test results can’t tell you the time
it was left; is that correct?
A.	� Correct.
Q.	� The DNA test results can’t tell you the date
it was left; is that correct?
A.	� Correct.
Q.	� The DNA test results can’t tell you whether it
was deposited consensually; is that correct?
A.	� Correct.
If defense theory favors opposing the government’s claims regarding the DNA evidence
— that is, if the defense theory is that the defendant’s DNA is not where the prosecution says
it is — then cross-examination of the government witnesses may be the primary strategy
for undermining the evidence and showing the
jury why they should discount it. The goal of the
adversarial cross-examination should not be to
spar with or outwit the expert but, instead, to
systematically highlight the shortcomings of the
procedures that led to the DNA report asserting
that, for example, the defendant’s DNA profile
cannot be excluded as admissible evidence.

Time,­place,­transfer­and­contamination
In most cases — except some sexual assault
cases — analysts cannot say exactly when or
under what circumstances DNA came into contact with a piece of evidence. DNA at a crime
scene may have been left there days, weeks or
months before the crime, or after the crime was
committed. A person or object may have transferred the DNA there. If the defendant’s DNA is
present at the crime scene or on an object recovered from the crime scene, this does not mean
with any certainty that he or she was present at
the crime scene at any time. The government

DNA	

INITIATIVE

analyst should concede these points easily; they
may be worth exploring on cross-examination
if the defense theory suggests contamination,
transfer or the innocent presence of the defendant at the scene at a different point in time.
Many labs do not attempt to distinguish between
vaginal and skin cells. A scientist may be able
to obtain a DNA profile but not be able to testify
that the source definitely was vaginal fluid or
skin. Contrast this with the confirmatory tests for
semen. Most of the time, scientists can confirm
that the DNA profile came from sperm cells.
The defendant’s DNA may have come into contact with an item of evidence through contamination. As a preliminary matter, counsel should look
carefully at chain-of-custody logs for every step
of the process — from the crime scene to the
laboratory to the analyst’s workstation, and any
other movement or handling in between (including any time evidence was removed from storage and then returned). If the defendant’s known
DNA sample was handled on the same day as,
and in particular before, an item of evidence —
which the laboratory’s protocols may prohibit
— there may be reason to think that the defendant’s DNA was transferred to the evidence
through mishandling. If the defense theory is that
the DNA was contaminated, counsel should proceed with caution and be prepared to elicit evidence in support, through either the DNA analyst
or others who came in contact with the evidence
during the chain of custody.
Under either a transfer or contamination theory,
counsel will want to find a compelling way to
illustrate to jurors how little DNA is required
for it to register on the analyst’s instrument.
Depending on which DNA testing kit is used, one
nanogram or less is considered to be an optimal
amount of DNA for testing. Defense attorney
Bob Blasier famously illustrated this concept:
Hold up a packet of sugar and note that it contains approximately 1 gram of sugar. Assume the
packet contains 1,000 individual granules. Confirm with the analyst that given this premise, to
obtain a nanogram of sugar they would need to
divide a single crystal by 1,000, and then divide
one of those pieces by 1,000, and then again.
Finally, the expert will agree, you are at 1 nanogram, or less than the eye can see — and that
amount, or less, is all that is needed for a person’s DNA profile to appear in a test result. That

­
97

CHAPTER 8

amount of DNA might be transferred by a small
number of skin cells that came in contact with
a person or object, which later came in contact
with another object. If counsel picks up a pen
in the courtroom, the expert will probably agree
that there is a fair chance that counsel’s DNA is
now on that pen by way of shed skin cells.
In short, miniscule amounts of DNA can be transferred easily. This line of cross-examination can
be effective under a theory of simple transfer or
contamination. Factors such as evidence packaging, handling and chain of custody are critical to
developing the facts necessary to support such a
theory.

Statistics
Unless there is an opposing legal ruling, to be
in compliance with the current SWGDAM Guidelines, a DNA analyst should be presenting a statistic to characterize the significance of a match
involving DNA found on an item of evidence and
someone involved with the case. In non-mixture
cases — and often in distinguishable DNA mixture cases — that statistic will take the form of a
random match probability, as discussed in Chapter 6, Section 7. In an indistinguishable mixture
case, the statistic will likely take the form of a
combined probability of inclusion (CPI), a combined probability of exclusion (CPE), also called
random man not excluded (RMNE), or a likelihood ratio (LR).
One section of the adversarial cross-examination
should focus on the analyst’s statistical claims.
It is important to dispel what is known as the
prosecutor’s fallacy, which is a common misinterpretation of the random match probability statistic. If the probability that a randomly selected
individual would match the DNA profile found at
the scene is 1 in 1 trillion, that does not mean
that there is a 1-in-1-trillion chance that the DNA
came from someone other than the defendant.
It means that if a person is picked at random out
of the general population, the probability that he
or she will match the detected profile is 1 in 1
trillion.
The question of “What is the probability that the
evidence DNA profile came from the defendant
is not one that DNA testing that is supported

­98

with a traditional random match statistical calculation can address directly; however, some laboratories now use source attribution statements in
their DNA reports. A source attribution statement
is used to definitively state that, to a reasonable
degree of scientific certainty, this DNA profile
originated from this person, or their identical
twin. Source attribution testimony must actually
rely on demonstration via a statistical calculation
(typically in the case notes) that the obtained
DNA profile meets or exceeds the value set by
the lab in order to make such a statement. The
defense’s expert should be able to assist counsel
in locating the statistical data and publications on
which the lab relied to reach its conclusion and
design appropriate challenge questions.

Other­genetic­locations­(loci)
Another potential area for cross-examination is
that the inculpatory claims are being made on
the basis of a finite number of genetic locations
— most typically, the 13 core CODIS loci, the 15
STR loci in the Identifiler® kit, or the 15 STR loci
in the PowerPlex® 16 kit — of the literally billions
of genetic locations comprising the complete
human DNA chain.
The entire human DNA genome for each person
is unique (even identical twins). In forensic DNA
testing, however, only a finite number of autosomal STR genetic markers are examined (as
noted above, typically 13–15 areas). Research
strongly supports that it is necessary to examine
10 or more of these areas of DNA in order to be
able to distinguish between people, even those
who are related (with the exception of identical
twins, who will have the same autosomal STR
DNA profiles). The prosecution’s expert should
concede that other genetic loci developed for
forensic identification were not used in the current case. If the defendant was excluded at just
one of those other locations, the expert would
have to agree that the DNA must have originated
from another person — however, the analyst did
not test those other locations. Defense counsel
should be aware that forensic scientists within
a laboratory use whichever commercial test
kit their laboratory protocols specify. Although
there are a number of kits available that test for
additional genetic markers beyond the 13 core
CODIS loci, not all labs use the same kits.

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

Although the analyst’s laboratory may not be
in the practice of testing those other DNA locations, other laboratories do if they use a kit that
includes those additional loci. The argument
would therefore be that the analyst did not
send the DNA evidence to another lab to see
whether the defendant was excluded at one of
those other locations; instead, the analyst simply
offered a conclusion based on his or her lab’s
limited technology.
To support this line of cross-examination, counsel should learn exactly which locations were
tested, which locations are routinely tested at
the lab (determined by the commercial test kit
used), and what other locations are tested at
other labs (including the labs’ names and how
long they have been testing those other locations). Similarly, counsel should know the names
of both the test kit used in the case and the kits
used in labs that cover two or more locations.

Other­evidence­not­tested
A critical component of cross-examination may
be to highlight evidence that was not tested but
might have provided significant information. Evidence may not have been tested because:
■■

Items were not collected.

■■

Items were collected but not submitted to
the lab.

■■

A decision was made not to test a submitted
item because of case circumstances, direction from the submitting agency or limited
resources.

■■

A decision was made to test only a portion of
an item (for example, only some of several
stains on a bed sheet).

Also, the analyst may not have tested the DNA
of other potential suspects and thus did not compare the profiles of additional suspects to the
DNA found at the crime scene or qualifying run
mixtures through the databank to see if an alternative suspect(s) might have been identified as
a potential contributor(s). Such inquiries may be
particularly fruitful when the case involves a DNA
mixture with unaccounted-for alleles.

DNA

INITIATIVE

Mixtures­and­degraded­or­low-level­DNA
Mixtures and degraded or low-level DNA samples also provide fertile ground for the adversarial
cross-examination. Mixture interpretation can be
subjective, extremely complicated and susceptible to contextual bias. Interpretation of unresolvable mixtures, meaning ones where a major
and/or a minor contributor(s) profile(s) cannot be
discerned, is even more complicated — as is the
interpretation of complex mixtures, which typically contain DNA from three or more individuals. There have been cases where subjective
interpretations of mixtures have led to wrongful
convictions, such as in the case of Josiah Sutton
in Texas.10 Consultation with an expert is critical
when interpreting and understanding mixtures.
The relative peak heights of alleles might be
an appropriate area for cross-examination. For
example, if four alleles are found at a locus, it
may indicate a two-person mixture. When two
of these alleles are found in much greater concentration (major contributor) than the other two
(minor contributor), it can be presumed that the
two major alleles are from one source and the
two minor alleles are from another source. If the
laboratory reports that one major and one minor
allele go together to include the defendant, this
can be an area ripe for challenge. As noted in the
section on discovery (Chapter 3, Section 2), counsel should have a copy of the lab’s protocols as
well as the protocols from other labs — including
the FBI — to screen for discrepancies between
the protocols governing this lab’s practices and
others in the field. Pay particular attention to
areas where the analyst’s discretion factors into
the analytic outcome.
Another fertile area for cross-examination with
mixtures, as well as low-level DNA, deals with
what is observed below the analytical threshold. Each laboratory will determine the analytical threshold for their instruments, based upon
their validation studies. The analytical threshold
defines the minimum height requirement at and
above which detected peaks can be reliably be
distinguished from background noise on the
electropherograms. Peaks above the threshold
are typically not due to noise and are either true
alleles or artifacts. Conversely, any peaks below
the threshold cannot reliably be distinguished

­
99

CHAPTER 8

from background noise. DNA analysts should
acknowledge that, generally speaking, alleles corresponding to genetic material can be observed
below the analytical threshold set by their lab
and that these peaks would not be listed in their
report.
The current version of the SWGDAM Guidelines
(released January 14, 2010) specifically prohibit
this practice, as stated in Guideline 3.1.1.2:
“…the analytical threshold should be established based on signal-to-noise considerations
(i.e., distinguishing potential allelic peaks from
background). The analytical threshold should not
be established for purposes of avoiding artifact
labeling, as such may result in the potential loss
of allelic data.”
It is essential to determine whether there is
any additional information (especially below the
lab’s reportable/analytical threshold) that did not
appear in the final report but may be contained
in the supporting data or electropherogram
printouts.
Even data analyzed by the lab using an analytical threshold supported by empirical data can
and should be reviewed by the defense expert,
particularly when the testing involves a mixture,
partial, or low-level DNA sample. For example,
data detected below the threshold may suggest
the presence of a third party. DNA present at low
levels may also contradict the conclusions made
by the analyst based on the above-threshold
DNA. Particularly in low-level DNA samples,
there may be information below the threshold
that could potentially exclude the defendant. The
defense expert should assist counsel in ascertaining whether there is additional information
that could help the defense’s case.
The lab that conducted the DNA analysis may
have an exception to application of their set analytical threshold in place — either you or your
expert should look for this in their protocol. The
purpose of this exception is to allow the analyst,
in conjunction with their technical reviewer,
to use analytical data below the threshold to
exclude a suspect when that additional data supports such an exclusion. It is important to note
that this practice also requires an exception to

­100

the standard operating procedure of interpreting
the data (identifying all peaks that are suitable
for comparisons) prior to all comparisons. While
that would still be done, this exception allows
the lab to take allelic information below threshold into account after they have compared the
suspect’s profile to the reportable alleles. If there
is a concern about the lab not having reported
alleles deemed by the defense expert to support a conclusion that would exclude your client
(rather than include him/her or report the results
as inconclusive/uninterpretable), it is appropriate to ask the analyst if they are aware of cases/
information in their protocol that allows the lab
to engage in this exception and exclude based
on data below threshold. If the lab is not applying this exception, this may serve to support the
defense expert’s contention.

Artifacts
Another area for the adversarial cross-examination is any instance in which the government
expert characterizes a blip on the electropherogram as stutter, a dye blob, a spike or an artifact
of any kind — or, in the absence of a blip/peak,
as with allelic drop-out. In some cases, an alternate interpretation of these phenomena — that
is, that the blip/peak represents an allele from
genetic material rather than a technical artifact,
or that the absence of a blip/peak means there
really is no DNA present — may lead to an interpretation that excludes the defendant.
These phenomena have been observed to exist
(see Chapter 6, Section 3). Every determination
in a case involves a certain element of subjectivity, and contextual bias can be particularly problematic when distinguishing between legitimate
stutter and actual alleles from genetic material
that is located in a stutter position.
Counsel should pay particular attention to the
laboratory’s stutter protocols; any deviation from
those protocols should raise a red flag — however it is important to be aware that an exception to
the general guidelines listed in the lab’s protocol
will always be a possibility. The current version
of the SWGDAM Guidelines takes care to point
this out, as stated in Guideline 3.5.8.3, which
addresses interpretation of potential stutter peaks

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

in a mixed sample. Guideline 3.5.8.3 states: “If a
peak is at or below this expectation [with being
of allelic origin], it is generally assigned as a stutter peak. However, it should also be considered
as a possible allelic peak, particularly if the peak
height of the potential stutter peaks(s) is consistent with (or greater than) the heights observed
for any allelic peaks that are conclusively attributed (i.e., peaks in non-stutter positions) to the
minor contributor(s).” Accordingly, when there
is a mixture sample in which minor contributors are determined to be present, a given peak
might fall within both the technical range for
stutter and the relative range for a heterozygous
counterpart to another peak identified as an allele
corresponding to genetic material. This situation
provides an opportunity for a different in interpretation of the findings.

A­chain­of­assumptions
When preparing to cross-examine the government DNA analyst, it is critical to work with the
defense expert to identify, first and foremost,
that the electronic data counsel receives match
the report in accordance with the laboratory’s
protocols. The expert should evaluate every judgment call, every below-threshold peak and “blip”
on the electropherogram that was discounted as
stutter, a dye blob, a spike, noise, or other artifact as a possible ground for cross-examination.
In addition, counsel/their expert should review
any instance where the absence of DNA was
determined to be allelic drop-out. Counsel should
also explore every alternative explanation for
every determination made by the analyst.
This series of judgments can be characterized as
a “chain of assumptions” on which the analyst’s
testimony hinges. The jury must be firmly convinced that every single assumption is correct.
If any one of those assumptions turns out to be
incorrect, this can be used to infer that the conclusion drawn by the analyst may not be correct.
Counsel may be able to persuade the jury that a
chain of assumptions — each of which was arguably reached on the basis of an assumption of
guilt — is a violation of the defendant’s presumption of innocence and cannot meet the standard
for a criminal conviction.

DNA

INITIATIVE

The­nonadversarial­or­“teaching”­­
cross-examination
Alternately, the defense may concede (for strategic reasons) that the DNA evidence is what
the government analyst says it is — namely, the
evidence profile matches the defendant and was
extracted from a particular type of body fluid (see
Chapter 2, Section 2). In short, the analyst is
exactly right.
It may be that the defendant had intercourse
with the murder victim some time before the
murder, which the defense does not dispute.
It may be that the defendant was in the home
where the homicide took place, and the DNA
supports this — which is consistent with defense
theory because the defendant visited the victim
the day before. Whatever the facts, there are
scenarios in which defense counsel may not
want to dispute claims made by the DNA analyst.
In such cases, counsel may opt to use crossexamination as an opportunity to teach the jury
about how “good science” is done to contrast it
with the other forensic work in the case.
The teaching cross-examination can highlight
any scientific information in a forensic analysis.
A range of academic and scientific disciplines
supports the foundations of forensic DNA typing, from cellular biology to population genetics.
DNA examiners have highly detailed protocols
for what constitutes a match and always rely on
validated population databases to generate statistics estimating the probability that two samples
have the same profile. Some DNA analysts will
not make absolute claims of identity. Regardless,
all DNA analysts rely on advanced technology to
generate charts of observed alleles, which are
associated with specific frequency values which
serve as the basis of statistical or identity claims.
The databases and associated statistics have
been validated. Furthermore, all of the underlying data that serve as the basis of the analyst’s
claims are provided to the defense.
In short, forensic DNA typing analysis is a rigorous scientific process, which can be developed
in detail on cross-examination and later contrasted with the practices of other forensic disciplines
in the case.

­
101

CHAPTER 8

Section­10:­Special­Considerations­
for­Trying­mtDNA­Cases
Basic­mtDNA­typing­premise­—­­
not­an­identification
mtDNA is different from nuclear (autosomal)
DNA — the most commonly encountered forensic variety — in a number of ways. A careful
challenge to mtDNA evidence should hone in
on these differences while following the general
guidelines above. Below is a synopsis of the core
areas of forensic mtDNA that can be developed
through admissibility challenges under Frye,
Daubert or other evidentiary standards governing
expert testimony and scientific evidence, or as a
basis for challenging the expert directly through
cross-examination. Refer to Chapter 2, Section 3,
for information regarding the biology of mtDNA.
Any attempt to characterize a purported mtDNA
“match” as evidence of conclusive identity is
scientifically unsupportable on the basis of its
method of inheritance alone. Scientists are in
agreement that “[m]itochondrial DNA typing
does not provide definitive identification.”11 This
should be brought to the attention of a judge or
jury considering such evidence.

Contamination­concerns­in­mtDNA­typing
Because mtDNA analysis almost always involves
working with very low amounts of template
DNA, from the outset of the DNA sequencing
typing process there is considered to be a far
higher risk of contamination than with nuclear
DNA typing. In addition, this work with small
amounts of DNA dictates the need for more
cycles of PCR amplification to generate typing
results for each sample, plus the detection method is very sensitive. The risk of contamination in
mtDNA analysis has been deemed substantial
and, indeed, even more precautions must be
undertaken in a lab that conducts mtDNA testing
to avoid the introduction of contamination than in
a lab that solely conducts nuclear DNA testing.
The SWGDAM Guidelines for Mitochondrial DNA
(mtDNA) Nucleotide Sequence Interpretation
(released April of 2003) [see http://www.fbi.gov/
about-us/lab/forensic-science-communications/
fsc/april2003/swgdammitodna.htm] states that

­102

low levels of exogenous DNA contamination
and/or background is commonly observed. With
respect to contamination, the SWGDAM mtDNA
Guidelines require that mtDNA labs:
■■

Take precautions to minimize contamination.

■■

Monitor contamination.

■■

Have a method to define and quantify
contamination.

■■

Determine their maximum allowable threshold
for contamination through internal validation
studies.

■■

Have standard operating procedures in place
to deal with contamination.

■■

Establish evaluation criteria for controls,
including but not limited to a positive control,
a negative control, and a reagent blank control,
each of which has been processed through
sequencing along with the sample.

If more than one person’s DNA is extracted and
amplified, the sequencing results may reflect this
mixture. In extreme cases, the contaminating
DNA can greatly exceed the donor’s DNA and
thereby yield a false positive result.12 To address
this issue, the FBI has established a “contamination ratio” of 10:1 — meaning that the FBI
considers one part contamination per 10 parts
mtDNA sample to be suitable for interpretation.13
Defense counsel should question the underlying data on which the FBI, or another laboratory,
relies in permitting the use of their contamination
ratio. Counsel should also be aware that the FBI
supports four regional mitochondrial DNA testing
labs, located in Arizona, Connecticut, Minnesota
and New Jersey, to perform mtDNA testing,
which means these labs are likely to have similar
protocols.
In 2001, a commercial laboratory reported the
results of a two-year study of thousands of trials
to determine the effect of heteroplasmy, contamination and other factors on lab mtDNA test
results.14 The researchers found the presence
of contaminants in 2.4 percent of cases.15 The
source of the contamination was not lab staff;
the researchers determined that the contaminants came from a source outside the laboratory.
In at least two cases, the contamination affected
the interpretation of results.16

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

The­role­of­heteroplasmy­in­forensic­typing­
of­mtDNA
Forensic analysts account for the biological
anomalies of mtDNA by applying a more flexible
standard for declaring a match, reported as “cannot exclude,” between two profiles. Whereas a
match between nuclear DNA profiles is straightforward in non-mixture cases, it is less so with
mtDNA. At the outset, a DNA analyst sequences
the HVI and HVII regions of both the evidence
sample and the suspect’s sample. If the two
profiles fail to match at all base positions, most
laboratories — in accordance with their written
protocol — will not exclude the suspect as the
source of the evidence sample. Instead, most
crime labs “will only definitively exclude a suspect if there are two or more base-pair differences between the samples with no evidence of
heteroplasmy, on the theory that one difference
may be the result of heteroplasmy.”17
The defense’s challenge to a purported mtDNA
match might begin by highlighting the fluidity of
the definition crime laboratories have adopted to
accommodate the biological realities of mtDNA.
Crime labs hold that a mtDNA match is always
a match and, because of heteroplasmy, what
appears to be a nonmatch at one or two base
positions may not exclude an individual. From a
legal perspective, a protocol that not only allows
but requires interpretation of apparently exculpatory evidence in a manner that renders the same
evidence inculpatory may raise concerns about
observer bias.
Although some crime labs will only declare an
automatic exclusion in cases where one or more
differences are observed between the evidence
sample and the suspect sample, they will declare
an inclusion (or “failure to exclude”) under a
variety of scenarios. For example, if an analyst
concludes that the profiles being compared are
identical at each of the bases in the HVI and HVII
regions, the suspect will be deemed “included
(or not excluded) as a possible contributor of the
evidence sample.”18 If either the suspect or evidence sample displays heteroplasmy, the analyst
will not necessarily exclude the suspect as a
possible source when two or less differences are
noted between the sequences based upon the
evaluation of the number, position, and nucleotide composition of polymorphic sites.19 Moreover, if the two sequences differ by a single base

DNA

INITIATIVE

pair but neither profile appears heteroplasmic,
the analyst will not necessarily exclude the suspect; instead, the analyst may characterize the
results as inconclusive based upon the evaluation
of the number, position, and nucleotide composition of polymorphic sites, notwithstanding the
seemingly different profiles.20 The exact criteria
for distinguishing a “failure to exclude” from an
actual exclusion vary from laboratory to laboratory, with little standardization.21

Basic­mtDNA­database­issues
After determining that there is a failure to
exclude, or “determining that the mtDNA profile
of a reference sample and an evidence sample
cannot be excluded as potentially originating
from the same source” using one of the above
suppositions, the analyst will then compare the
sample to a database(s) of profiles to estimate its
significance.22-23 The population databases used
to determine a random match frequency estimate for mtDNA results differ from those used
in nuclear autosomal STR DNA cases to generate a random match probability. With mtDNA
testing results, the counting method is the most
common approach used. The counting method
involves counting the number of times that a particular mtDNA sequence is seen in a database.
The larger the number of unrelated individuals
in the database, the better the statistics will be
for a random match frequency estimate. It has
been argued that using a database of mtDNA
profiles representative of the relevant population
is essential.
An admissibility challenge to mtDNA evidence
can focus principally on the apparent shortcomings of the databases used to derive the statistical expression that serves as a prerequisite to
admission of the evidence. The FBI maintains the
primary mtDNA database used for forensic analysis in the United States (the SWGDAM mtDNA
Population Database). In 2004, a team of scientists assessed the reliability of the FBI mtDNA
database. Using the African-American mtDNA
sub-database to serve as the basis of a “thorough inspection,”24 they found that the SWGDAM
database contained “a number of major deficiencies.”25 Steps have been taken since that time to
address the identified concerns.

­
103

CHAPTER 8

mtDNA­database­quality­control­issues
On the basis of the 2004 review, scientists have
been critical of the SWGDAM mtDNA database;
at that time, errors relating to the accuracy of
the profiles that populate the database were
observed.
The lack of sufficient quality control standards
governing the initial typing of the profiles resulted in a number of errors. Molecular biologists
Y.G. Yao and colleagues identified “five major
and common types of errors, namely, base
shifts, reference bias, phantom mutations, base
mis-scoring and artificial recombination” within
forensic mtDNA databases.26 They described the
need for quality control standards as “urgent”
and recommended “[e]xtreme caution … at all
stages of data collection and proofreading processes.”27 As indicated above, steps have been
taken to address these and other deficiencies
noted in the mtDNA databases during the intervening period. In addition, the International Society for Forensic Genetics (ISFG) EMPOP mtDNA
database is available for use (see http://empop.
org/), if preferred and/or to compare the random match frequency estimates obtained. The
mtDNA haplotypes in the EMPOP database are
stored in difference-coded format, relative to the
revised Cambridge Reference Sequence (rCRS)
and aligned using the phylogenetic approach
described by Bandelt and Parsons in 2008. [See
Bandelt, H.J., and W. Parsons (2008), Consistent treatment of length variants in the human
mtDNA control region: A reappraisal. Int’l J. Legal
Med. 122(1), 11-21.] Per Bandelt and Parsons:
In forensic science, as well as in molecular anthropology and medical genetics,
human mitochondrial DNA (mtDNA) variation is being recorded by aligning mtDNA
sequences to the revised Cambridge reference sequence (rCRS). This task is straightforward for the vast majority of nucleotide
positions but appears to be difficult for
some short sequence stretches, namely, in
regions displaying length variation. Earlier
guidelines for imposing a unique alignment
relied on binary alignment to a standard
sequence (the rCRS) and used additional
priority rules for resolving ambiguities. It
turns out, however, that these rules have
not been applied rigorously and led to inconsistent nomenclature. There is no way to

­104

adapt the priority rules in a reasonable way
because binary alignment to a standard
sequence is bound to produce artificial alignments that may place sequences separated
by a single mutation at mismatch distance
larger than 1. To remedy the situation, we
propose a phylogenetic approach for multiple alignment and resulting notation.
In their 2004 analysis of the African-American
subpopulation database, Bandelt and colleagues
“detected as many as five artificial combinations
of totally unrelated mtDNA segments stemming
from different samples, which suggest fatal
sample mix-up in the lab or during data transcription.”28 Even following their report and a series
of revisions by the FBI, “several obvious clerical
errors still remain in the revised database.”29
According to Bandelt and colleagues, the remaining errors “could only be corrected through thorough resequencing of the original samples.”30
The FBI has not published the results of any such
resequencing.

The­counting­method
One of the database’s deficiencies is that it may
not be accurately representative of the subpopulations it claims to represent. As of October
2008, the entire SWGDAM mtDNA database
contained 5,071 profiles divided across 14 racial
subpopulations. The populations and number of
profiles at that time are listed in Figure 25.
Some population/geographic groups are represented by fewer than 100 profiles — in one case,
by as few as eight for a portion of a population
group. The profiles were gathered from a collection of blood banks, paternity-testing labs, scientific research groups and FBI agents.31 The racial
classifications are based on self-reporting, not
genetic ancestry. The samples are not geographically defined. The SWGDAM mtDNA database is
an example of a “convenience sample” obtained
from only a handful of locations; no effort was
made to randomize the selection.32
The number of profiles in the EMPOP database
in mid-April of 2011 was more than 8,000. To
find out how many mtDNA haplotypes are in this
collaborative database at any point in time, see
http://empop.org/modules/overview/. The number of haplotypes in the database for each

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

Figure­25:­mtDNA­Database
Race

Number­of­Profiles

African-Americans

1,148

Apaches

180

Caucasians

1,814

Chinese/Taiwanese

356

Egyptians

48

Guamanians

87

Hispanics

759

Indians

19

Japanese

163

Koreans

182

Navajos

146

Pakistanis

8

Sierra Leone

109

Thai

52

TOTAL

5,071

Source: SWGDAM Guidelines for Mitochondrial DNA
(mtDNA) Nucleotide Sequence Interpretation (October 2008),
Federal Bureau of Investigation.

geographic affiliation can be seen by selecting
each region, using the “geographic affiliation
filter.”
Because mtDNA is maternally inherited and not
recombinant, mtDNA profiles are not randomly
distributed across the population. The distribution of a given mtDNA sequence is a function of
women’s migration and reproduction rates. An
individual and all of his or her siblings — as well
as their mother, grandmother, great-grandmother
and maternally related third cousins, and so on
— are expected (absent mutations) to share identical mtDNA profiles. Over generations, profiles
stay intact or mutate to a very similar sequence.
In addition, the high mutation rates characteristic of the HVI and HVII regions create unique
variants. More recently created variants in the
human population may not have had time to
spread from their location of origin. This creates
geographical areas where certain haplotypes (the
collective genotype of closely linked loci on an
area of DNA) or haplogroups (groups of similar
haplotypes) are prevalent and other areas where
they are wholly or largely nonexistent.

DNA

INITIATIVE

To calculate the statistical frequency within the
mtDNA database, a forensic analyst counts the
number of times a particular profile occurs in the
database(s) being used. This is known as the
counting method.33 Given that vast majority of
mtDNA profiles have most likely not been generated, the “count” of a given profile is often zero
out of the number of profiles already observed in
the population database.
When a profile is observed at least once, the
conventional statistical calculation involves
dividing the number of observations by the size
of the database.34 For example, if the profile
was observed once in the African-American
database (n = 1,148), the frequency would be
reported as 1/1,148 or 0.0008711. The analyst
would then place a 95-percent confidence interval around that number as a margin of error in
estimating the frequency in the larger human
population.35 The laboratory would report the
upper-bound frequency: For an observed frequency of 0.0008711, the upper confidence limit
is 0.004839, or 0.48 percent. Thus, the lab would
report that the frequency of occurrence in unrelated individuals of the observed haplotype in
the African-American population is 0.48% — this
could also be reported as 99.52% of all AfricanAmericans are excluded as having the observed
haplotype.36 The lab may report the observed
counts within subpopulations as well as from
the overall database. Regardless, there should
always be a qualifier that explains that individuals
within the same matrilineage will have the same
mtDNA haplotype (barring mutation).

mtDNA­database­profiles­may­not­be­­
representative­of­some­subpopulations
Dozens of phylogeographic37 studies have been
performed to identify the geographic distribution of mtDNA haplotypes in regions all over
the world. These studies are fairly limited in the
United States.
These studies show that mtDNA is not randomly
distributed throughout the world; different haplogroups and haplotypes are concentrated within
certain geographical populations.38 Scientists
rarely encounter new nuclear DNA haplotypes
when studying new population subgroups, but
the opposite is true for mtDNA. Although some
haplogroups of mtDNA sequences are widely

­
105

CHAPTER 8

distributed throughout the population,39 many
exist only within certain geographic clusters.40
Nonrandom distributions also exist within geographic locations because of subtle linguistic,
religious or economic/caste distinctions.41 This is
not a surprising observation.
These distributions are not limited to rare or
ancient populations — today, different geographic regions demonstrate different mtDNA
patterns.42 For example, a particular cluster of
mtDNA sequences called Haplogroup J is widely
distributed in western and central Europe, but is
rare in Iberia.43 A sub-haplogroup of that cluster
has been observed primarily in Britain, with one
other occurrence from an ancestor in Italy.44 A
mutation that has an 8-percent frequency within
the Canary Islands has never been found outside
the Islands.45 One study identified a considerable
number of matches between Mozambique and
American sequences from African haplogroups,
including some sequences that had never been
observed outside Mozambique and others
observed only in American populations.46 MtDNA
population genetic linkage in North America —
discussed in detail in the next two sections —
is also well documented in scientific research.47
Whether the heterogeneous geographic distribution of mtDNA lineages reflects genetic clustering, inadequate sampling or some combination of
the two, the sampling of mtDNA profiles should
take into account geographic heterogeneity
and stratification in order to create representative databases for use in forensic typing. This
concern applies to the various ethnic groups in
the United States — whether African-American,
Hispanic, Asian or otherwise (although less so for
Caucasians).

­106

defendant resides and the region(s) from which
the population databases were collected.
At minimum, defense counsel should learn about
the historical and contemporary migration patterns from the defendant’s ancestral origin to
both the geographic location where he or she
resides and the location(s) from which the database samples were drawn. If, for example, a
defendant’s ancestral origins are not represented
in the mtDNA database, but he is a member of
a significant immigrant community of common
origin in his place of residence, a strong argument can be made that the lack of a match to
his mtDNA profile in a database collected from a
random set of individuals from elsewhere in the
country or world is devoid of meaning. It offers
no information about the frequency of that profile
in the relevant geographic area.

mtDNA­defense­experts
If an admissibility challenge fails, the defense
may want to consider retaining its own expert.
The same strategic considerations generally
apply: If the government calls a forensic scientist
and the necessary points cannot be developed
sufficiently on cross-examination, the defense
may want to call a scientist with expertise in the
underlying science and/or population genetics to
challenge the government expert’s claims.

Detailed information about the effect of migration
patterns on African-American,48-64 Hispanic,65-66
Native-American,67-69 Asian,70-74 and Caucasian75-76
populations is readily available.

In a mtDNA case, the defense may also want to
call an expert on the migration patterns of the
defendant’s ancestors to show that his or her
haplogroup is not properly represented by the
database the government relied on for its statistical representation. Counsel should be aware that
the SWGDAM database is not the only mtDNA
database available, as noted above. Alternate
databases can be located on the Internet, including, but not limited to, www.mitomap.org and
www.empop.org.

The­role­of­ethnicity­in­trying­a­mtDNA­case

mtDNA­treatment­in­the­courts

The defendant’s ethnic background may play a
critical role in informing the appropriate defense
strategy in a mtDNA case — given the population substructuring described above and its influence on the distribution and frequency of a given
mtDNA profile in both the region in which the

A number of challenges have been made to the
admissibility of mtDNA evidence as an inculpatory tool, but they have been generally unsuccessful thus far. Many courts have acknowledged
that “mtDNA analysis is more applicable for
exclusionary, rather than identification, purposes,”77 but have nonetheless admitted the

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

evidence on grounds that the discriminatory
power and other limitations of mtDNA evidence
are questions of weight rather than admissibility.78 Appellate courts in at least 11 states79 as
well as one federal district court80 have found
the results of mtDNA testing admissible under
various evidentiary standards. Fresh admissibility
challenges are critical, however, in light of the
studies that called the reliability of mtDNA forensic databases — and, thus, the inculpatory claims
hinging on them — into question.

Section­11:­Special­Considerations­
for­Trying­Y-STR­Cases
Y-chromosome DNA — from which Y-STR forensic markers are derived — differs from traditional
nuclear DNA on a number of counts. Just as with
mtDNA, a well-planned challenge to Y-STR DNA
evidence should hone in on those differences
while following the general guidelines for DNA
cases outlined above.
Below is a synopsis of the core substantive areas
of forensic Y-STR DNA that can be developed
through admissibility challenges under Frye,
Daubert or other evidentiary standards governing
expert testimony and scientific evidence, or as a
basis for challenging the expert directly through
cross-examination. Refer to Chapter 2, Section 3,
for basic biological information about Y-STRs.
Any attempt to characterize a purported Y-STR
“match” as evidence of conclusive identity is scientifically unsupportable on the basis of its method of inheritance alone. Any lab report conclusion
of an inclusion, or match, must be qualified in a
manner that clearly points out that other males in
the same lineage will have the same Y-STR haplotype (barring mutation) as the one generated
from the item of evidence.

The­limited­discriminatory­power­of­Y-STRs
Y-STR profiles are exactly the same among related males within patrilineal lines. Although Y-STR
DNA has proven to be a powerful exclusionary
tool, its ability to inculpate is less powerful. Far
short of identifying a particular person as the
source of a Y-STR profile, observing that a suspect profile is consistent with an evidence sample does no more than reduce the population of

DNA

INITIATIVE

possible contributors to the defendant plus “all
patrilineal related male relatives and an unknown
number of unrelated males as being the donor
of the evidence sample.”81 Consequently, “the
observation of a match with Y-STRs does not
carry the power of discrimination and weight into
court as an autosomal STR match.”82

Frequency­estimates­and­Y-STR­­
population­databases
As with mtDNA, Y-STR population databases
may also provide fertile ground for defense challenges. As with any DNA match evidence, the
ability to assign significance to the match hinges
on the reliability of the databases used to conduct the statistical calculations. Refer to http://
www.cstl.nist.gov/strbase/y_strs.htm for Y-STR
haplotype databases commonly used in the
forensic community. The current number of haplotype profiles available for searching using the
Consolidated U.S. Y-STR Database (http://www.
usystrdatabase.org/) can be obtained by selecting the “Database Descriptive Statistics” tab
at the top of the Web page. The resulting page
for release 2.4 of the database (as of January 2,
2011) lists the “Total Number of Haplotypes (N)”
as 18,547 (see http://www.usystrdatabase.org//
pdf/DatabaseDescriptiveStatistics.pdf).

Y-STR­profiles­cluster­regionally
Not surprisingly, Y-STR profiles cluster geographically, following migration and settlement
patterns. These clusters are discernible among
major population groups (for example, Caucasian, African-American and Hispanic). Studies
have shown that there are statistically significant
differences in the frequency of Y-STR profiles
within some discrete ethnic groups, depending
on which geographic locations are sampled.83
Some Y-STR profiles are very common in certain geographic locales and much less common
in others. Consult with an expert to determine
whether ethnic clustering issues may exist in the
particular case.
As a result of the substantial geographic substructuring of Y-STR DNA profiles, some scientists have expressed “particular concern [over]
the sampling of multiple populations and their
assembly into global databases.”84 When Buckleton et al. surveyed available scientific literature in

­
107

CHAPTER 8

2005, they found “no report in the literature yet
of how to interpret Y-chromosome haplotypes
accounting for population subdivision.”85 They
reported that “further investigation into how to
compensate for population subdivision at the Y
chromosome is warranted urgently” and said
that “it is imperative that every effort should be
made to use appropriate local databases” when
attempting to estimate the frequency of a given
Y-STR profile.86 Guideline 5.6 of the SWGDAM
Y-chromosome Short Tandem Repeat (Y-STR)
Interpretation Guidelines (released January of
2009) [http://www.fbi.gov/about-us/forensicscience-communications/fsc/jan2009/standards/
2009_01_standards01.htm] states, “It is recognized that population substructure exists for
Y-STR haplotypes. Studies with current population databases have shown that the FST values
are very small for most populations. Thus the
use of the counting method that incorporates
the upper-bound estimate of the count proportion offers an appropriate and conservative statistical approach to evaluating the probative value
of a match.”

The­role­of­ethnicity­in­trying­a­Y-STR­case
The defendant’s ethnic background may play a
critical role in informing the defense strategy in
a Y-STR DNA case. At minimum, defense counsel must be aware of the defendant’s ethnic
background because he may be a member of
a significant immigrant community of common
patrilineal origin. If the defendant’s ethnic background is not represented by the database(s)
searched, defense counsel should consider hiring
an expert to help determine the significance —
or lack thereof — of the statistics provided.
For example, consider a defendant from San
Miguel (in eastern El Salvador), who immigrated
to Washington, D.C., along with many of his
countrymen in the last 20 or 30 years.87 The
Salvadoran population of the D.C. region is a
new community, having emerged within a single
generation; in fact, this phenomenon of recent
immigration helped the District earn the title
“immigrant gateway.”88 With limited opportunity
for intermingling with established local communities, the Salvadoran population in the district may
be genetically insulated.

­108

The defense can argue that the District’s Salvadoran community is unique, due not only to the
recency of its emergence but also to its unique
genetic ancestry. The Salvadoran source population is unlike the more common sources of Hispanic immigrants to the United States, such as
those from Mexico or Puerto Rico. In El Salvador,
the native Indian population remained largely
intact despite Spanish conquests.89 In Mexico, by
contrast, the majority of inhabitants have been
classified as “mestizos,” who are genetically
traceable to a mixture of European and African
ancestry. Puerto Ricans are heavily of European
and West African descent.90 Thus, Salvadoran
immigrants, as a group, might be expected to be
genetically distinct from other Hispanics residing
in the United States.
There may also be some genetic variation within
the Salvadoran population. For example, Salvadorans now residing in the D.C. metropolitan
area have a markedly different ancestry than
their countrymen who immigrated to other major
U.S. destinations such as Los Angeles and other
parts of California. Those who immigrated to the
District of Columbia came predominantly from
eastern El Salvador, from rural communities insulated from the urbanized centers of the West like
San Salvador, where presumably the majority of
genetic mixing would occur.91 Salvadoran immigrants who relocated to California, on the other
hand, came largely from the major metropolitan
areas in western El Salvador.92 In this example,
the defendant and his countrymen now calling
the District of Columbia home remain genetically
akin to the narrow subset of Salvadoran natives
occupying that particular, insulated region in eastern El Salvador.
Further amplifying the insulation and uniqueness
of the Salvadoran genetic fabric is that immigrating families tend to follow family members
who have gone before them.93 The effect is
even more dramatic when the gateway is new,
when the newcomer population has not yet had
the opportunity to mingle genetically with more
established populations in the region.
Arguments along these lines can be further substantiated with census data and other research
on migration and settlement patterns — and
then contrasted with information on the source

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

populations of the Y-STR database that was used
for the statistical significance requirement for the
matched evidence haplotype. With respect to
the Hispanic branch of the Y-STR database, it can
be argued that neither eastern Salvadorans nor
the Hispanic population of Washington, D.C., are
represented.

Defense­experts
If the government calls a forensic scientist and
the necessary points regarding Y-STR database
limitations cannot be developed sufficiently on
cross-examination, the defense may want to
call a scientist with expertise in the underlying
science to challenge the government expert’s
claims. In a Y-STR case, the defense may also
want to call an expert on the migration patterns
of the defendant’s ancestors to show that the
database the government used for its statistical
representation does not properly represent the
defendant’s Y-STR profile.

Y-STR­treatment­in­the­courts
A number of challenges have been made to the
admissibility of Y-STR evidence as an inculpatory
tool, but they have been generally unsuccessful
thus far. Y-STR “inclusion” evidence has been
admitted in several jurisdictions.94 Not all of these
cases have been fully litigated. Fresh admissibility challenges are worthy of consideration,
depending on the facts of the specific case.

Section­12:­Voir Dire­of­the­
Prosecution’s­DNA­Expert
Several questions emerge when preparing a
voir dire of a DNA expert. The first question is
whether to conduct a voir dire in the first place.
Voir dire has three basic goals:
■■

To exclude the witness’s expert testimony.

■■

To limit the witness’s expert testimony.

■■

To highlight for jurors why they should give
little or no weight to the opinion, even though
the witness is permitted to provide an expert
opinion.

DNA

INITIATIVE

Depending on defense strategy, counsel may
opt to conduct a detailed voir dire prior to the
expert’s direct testimony on the merits of the
case. Counsel may also opt to weave voir dire
questions based on answers provided into the
“bias” segment of cross-examination. Generally,
voir dire is conducted in front of the jury; however, especially in cases where the defense is
seeking exclusion or limitation of the expert opinion, counsel can ask the court to allow the voir
dire to occur outside the jury’s presence, either
before or after the jury is sworn in.
Regardless of strategy, counsel should review
the analyst’s curriculum vitae and perform an
extensive Internet search for all publications
and occurrences of the analyst’s name. To the
extent possible, investigate the contents of the
curriculum vitae, such as trainings, certifications and professional associations. If a claimed
credential can be earned by simply submitting a
fee, counsel should know how much the fee is
and, depending on the circumstances, consider
becoming a member. This line of voir dire can
help affect the testimony to come, creating a
degree of skepticism and potentially undermining
the expert’s authority in the minds of jurors.
Depending on the expert, counsel may also want
to challenge his or her educational background.
For example, if the prosecution’s expert does not
hold a master's degree or Ph.D. in a hard science,
counsel may make some headway with questions
that illuminate that the analyst is primarily a technician with minimal scientific training or little to
no training in molecular biology, statistics and/or
population genetics. Such questions can suggest
to the jury that the witness has minimal comprehension of the underlying science or little ability
to form judgment regarding its accuracy. Counsel
may consider delving into the specifics of what
the analyst studied in school, including undergraduate and graduate work, if applicable. Highlight
the irrelevancy and inadequacy of the training to
support the defense’s position — that the examiner is not trained to make the complex judgments
he or she is in court to express.
Counsel will also want to ask the expert to
acknowledge the authoritativeness of certain
publications — such as Dr. John Butler’s Forensic DNA Typing,95 Dr. John Buckleton’s Forensic
DNA Interpretation,96 one or both of the National
Research Council reports,97 or articles from

­
109

CHAPTER 8

authoritative journals that contain specific points
that bolster the defense theory. These publications can serve as the foundation for some of
the areas counsel will develop during crossexamination and potentially with subsequent
witnesses, including, if applicable, the defense’s
DNA expert.

Section­13:­Stipulations­—­
Qualifications­and/or­Results
In certain cases, counsel may wish to stipulate
to either the qualifications of the scientist or the
results of the DNA tests. These strategy decisions must be thought out well in advance.
Reasons for stipulating to a scientist’s qualifications may include a desire to downplay the
scientist’s training and expertise. Equally valid,
however, would be a desire to save time and
avoid the recitation of education and training.
For example, consider a criminal sexual conduct
case where the defense is arguing that the sex
was consensual. Because defense counsel is
not going to dispute the DNA evidence per se,
there is really no need for the state to bolster its
evidence by establishing that the scientist is well
trained. Another consideration is not to draw the
ire of the court or bore the jury with unnecessary
discussion of the expert’s qualifications.
The same example can be used to illustrate
when counsel may wish to stipulate to the
results. In light of the fact that consent is being
asserted, both the prosecution and the defense
may wish to spare the jury a lengthy explanation
of how PCR and capillary electrophoresis work.
The same may be true in a self-defense case or
when an insanity claim is asserted.
Caution should be used when considering stipulation. It is the exception, not the rule, in a DNA
case.

happen. As basic preparation, discovery should
provide defense counsel with a timeline of when
things were gathered and when they arrived at
the laboratory. The lab notes should tell counsel
the condition in which evidence arrived at the lab
— for example, how was the container sealed; if
there was moisture inside a heat-sealed plastic
bag; or a brown paper bag said to contain one
seat cover also included two socks, ChapStick®,
a comb, fingernail clippers and condom in sealed
wrapper, in addition to the seat cover.
Using the police reports, counsel will likely learn
which officers were at the scene at the same
time. Question the officers about any training
they have had regarding DNA evidence collection. An excellent outline of police officer
responsibilities can be found in the “Officers’
Responsibilities” section of What Every Law
Enforcement Officer Should Know About
DNA Evidence: Investigators and Evidence
Technicians.98
Cross-examination should focus on developing
the defense theory. When counsel knows the
answers, issues of contamination or transfer
should be addressed by asking leading questions
on the following topics:
■■

Having contact with the defendant before
collecting evidence.

■■

Playing a role in the defendant’s arrest.

■■

Having contact with the victim/witness/person
of interest (whose DNA has appeared in the
case) before collecting evidence.

■■

How the evidence was collected:
●■	

Were gloves worn?

●■	

Were gloves changed?

●■	

How often were gloves changed?

●■	

●■	

Section­14:­Questioning­Law­
Enforcement­on­Evidence­Collection­
and­Chain-of-Custody­Issues­
Ideally, every evidence collection would be videotaped. Practically speaking, this is not going to

­110

●■	

●■	

Was a list of collected evidence written
down?
Was the pen used to record the list of collected evidence cleaned to remove any
potential DNA on it before it was used at
the scene?
Is it your custom to write each thing as it is
collected or to do a laundry list at the end?
As a general habit, do you put your pen in
your mouth or use it to scratch yourself?

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

●■	

●■	

●■	

●■	

●■	

●■	

●■	

●■	

●■	

●■	

●■	

●■	

Did you cough or sneeze during the 

evidence collection process?
�

■■

Will the defense expert’s testimony be more
helpful than harmful?

Were you wearing a face mask over 

your nose and mouth?
�

■■

Can the defense expert communicate the
information in a way that keeps the jurors’
attention?

■■

Will having a defense expert neutralize or minimize the state’s DNA evidence and allow the
jurors to focus on other evidence in the case?

What did you do with the collected 

evidence?
�
Where was it stored or held while all of
the evidence was collected?
Was each piece of evidence sealed immediately after collection or were all bags
sealed at the end?
How long did it take to transport the 

evidence?
�
What were the storage conditions in the
evidence room?
How did the evidence get to the lab?

If the defense decides to call an expert to testify,
the selection of that witness is critical. Factors to
consider include:

Was the evidence in the trunk, glove box or
body of the car?

■■

Education.

■■

Experience.

Was the evidence in the front seat or back
seat?

■■

Prior testimony.

■■

Objectivity (worked for both sides).

■■

Demeanor.

■■

Ability to communicate complex issues in
understandable language.

What was done to minimize the risk of
contaminating DNA from getting on the
outside of the evidence containers?
Were all of the evidence envelopes and
bags put into one box for transport?

Cautionary note: It is a good idea to tour the
evidence room if given the opportunity. An unsecured evidence room — or a secured evidence
room with a door that can be propped open during nice weather — could have an impact on the
integrity of the evidence.

Section­15:­Defense­Expert­
Testimony­Issues
In most cases, an expert should be retained for
consultation. It is rare, however, that a defense
expert is called to testify.
Some considerations for whether defense counsel should call an expert to testify include:
■■

To support a public defender request for funding,
a lengthy record should be made, establishing
that an expert is necessary to adequately defend
the client. Counsel should emphasize supporting
case law and statutory law, where applicable.99

Can counsel develop evidence effectively and
persuasively through cross-examination of the
government expert?

DNA	

INITIATIVE

Considerations for the defense expert’s testimony include:
■■

Limit the expert to the important points.

■■

Make it interesting.

■■

Keep it relevant.

■■

Recall that jurors (like the rest of us) have varying learning styles. Try to incorporate visuals
in addition to verbal presentation to keep their
attention and assist in their understanding.

■■

Anticipate cross-examination.

Section­16:­Defense­Case­—­­
Stay­on­Theme
The decision to call an expert witness in the
defense case is significant. The defense may
call an expert who provides an explanation of
the DNA evidence contrary to the prosecution’s
explanation. The jury may find that the defense
expert is more credible or, at a minimum, conclude that the DNA evidence is not clear-cut and

­
111

CHAPTER 8

thus decide the case on the basis of other evidence. Although this approach has its rewards,
it also carries risks, primarily in the implicit suggestion that the jury can decide between the two
experts and not look only to the prosecution to
carry out its burden to prove the case beyond a
reasonable doubt.
Defense counsel may elect not to present its
own expert testimony. The defense may prefer
to have the jury focus exclusively on the quality
of the prosecution’s DNA evidence and whether,
in light of the cross-examination and other evidence in the case, the DNA evidence supports
the prosecution.
The decision whether to offer the testimony of a
defense DNA expert derives from the question,
“Does the testimony advance the theory of the
defense?” For example, if the defense theory is
that there was consent, there is little reason to
call an expert to testify that the state laboratory
failed to follow its own protocols in conducting
the DNA analysis. Conversely, if the defense
theory is that evidence was contaminated, counsel may benefit from calling an expert to testify
to quality assurance norms. The expert may be
able to comment on ways in which the state
failed to safeguard the crime scene DNA evidence from evidence seized from the defendant
or even from the defendant’s reference sample.
Also, in cases where the defense has developed
DNA evidence inconsistent with the defendant’s
guilt or consistent with the profile of a third-party
perpetrator, such results can have substantial
impact on the jury.
When considering whether to call an expert, prudent counsel will think carefully about how the
prosecutor will cross-examine the expert. Do the
positives of the testimony outweigh the negatives? Defense counsel should consider whether
the DNA evidence points to an important fact (for
example, the DNA profile on the hat identified
as worn by the assailant) or an unimportant matter (for example, an old beer can found on the
street, down the block from the shooting). Once
the expert is on the stand, the prosecution might
seek to turn the expert into a witness for the
prosecution, highlighting material favorable to its
case. Therefore, defense counsel should never
take lightly the decision to call an expert.

­112

Section­17:­Defense­Counsel’s­
Closing­Argument­in­a­DNA­Case
Before trial commences, counsel already should
have developed the defense, incorporating the
defense theory about the DNA evidence. Make
sure that the closing argument fits the defense
and works with the evidence that has been
presented.
Keep closing arguments simple and do not overstate the defense’s case. Do not get overly technical. Counsel’s job is to demystify DNA. If the
defense is attacking DNA, show that DNA can,
in part, be subjective. A simple presentation will
help covey that message. A simple, less technical presentation also will help empower the jury
to consider the DNA evidence critically. If jurors
believe they can understand and critically evaluate the evidence, counsel can persuade them to
look beyond the analyst’s conclusion of a DNA
match.
Visual aids can be powerful with the jury. Counsel should use visuals that are clear and make
the point they want jurors to understand. One
chart that has been used successfully shows
each allele call that involved a subjective interpretation by the analyst. In a case with a partial
profile, a mixture, or low-level DNA sample, there
may be a discrete number of times that an analyst made an interpretation adverse to the defendant, and a different interpretation at any point
could reasonably be interpreted to exculpate him
or her. Visually presenting this information to the
jury can be very compelling. Keep visual displays
simple and keep the connection with jurors.
Finally, anticipate and respond to the prosecution
where appropriate. In particular, in jurisdictions
where the prosecution gets the last word, make
sure the jury understands this and pre-empt
any arguments the prosecution might make in
response to the defense’s closing argument.

Section­18:­The­Prosecution’s­
Closing­Argument­in­a­DNA­Case
Defense counsel must be alert to possible factual and legal errors that may arise in a prosecutor’s closing argument, including:

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

Misuse of the DNA evidence: For example, the
failure to exclude a defendant from a DNA mixture from clothing left at the crime scene does
not prove that the defendant was at the scene
or that he or she was the last person to wear the
clothing. Counsel should object to the argument
of facts that are not supported by, or cannot be
inferred from, the trial evidence.
The prosecutor’s fallacy: This has been
explained by one court as “incorrect reasoning,”
that is, when the jury confuses the probability
of a random match with the potentially very different probability that the defendant is not the
source of the matching samples.100 If the random
match probability is 1 in 1 million, this does not
mean that there is a 1-in-1-million chance that
the DNA came from someone other than the
defendant. This can be addressed in a pre-closing
motion in limine or by objection during the
argument.
Burden shifting: Very often, the defense will not
present an expert to challenge the prosecution’s
DNA evidence. In closing, a prosecutor might
argue that the evidence is “unrebutted,” “the
defense could have brought in an expert to say
that something was wrong with this analysis,” or
“the defense could have done its own DNA testing but did not.” Such comments may be viewed
as shifting the burden of proof, as the defense
has no obligation to present such evidence.101
Comments on silence: Decisional law is strong
in precluding use of a defendant’s failure to testify and explain the evidence, as such comments
trespass on the individual’s privilege barring compelled self-incrimination.102
It must be noted that some comments otherwise
forbidden will be allowed if defense counsel has
“opened the door” or invited such a response.
Thus, the defense must carefully design its closing argument to overcome an objection on these
grounds.

Endnotes
1. Some articles and studies have examined
the issue of juror comprehension of scientific
testimony. See Dann, B.M., V.P. Hans and D.H.
Kaye, “Can Jury Trial Innovations Improve Juror
Understanding of DNA Evidence?” 255 NIJ J. 2

DNA

INITIATIVE

(2006); Reinstein, Myers, and Griller, “Complex
Scientific Evidence and the Jury,” 8 J udicatur e
150 (1999).
2. Studies on juror comprehension of DNA
include:
Dann, B.M., V.P. Hans and D. Kaye, Testing
the Effects of Selected Jury Trial Innovations on Juror Comprehension of Contested
mtDNA Evidence: Final Technical Report,
National Institute of Justice, Office of Justice Programs, U.S. Department of Justice,
Dec. 30, 2004.
Goodman, J., E. Greene and E.F. Loftus.
“What Confuses Jurors in Complex Cases,”
t r ial (November) 65-74 (1985).
Faigman, D.L., and A.J. Baglioni, “Bayes’
Theorem in the Trial Process: Instructing
Jurors on the Value of Statistical Evidence,”
12(1) l aw & H um . B e Hav . 1-17 (1988).
Kaye, D.H., and J.J. Koehler. “Can Jurors
Understand Probabilistic Evidence?” J.
r oyal S tat . S oc ’ y , Series A, 154, part 1,
75-81 (1991).
Koehler, J.J. “When Are People Persuaded
by DNA Match Statistics?” 25 l aw & H um .
B e Hav . 493-513 (2001).
Koehler, J.J. “Error and Exaggeration in the
Presentation of DNA Evidence at Trial,” 34
J ur im e ticS 34, 21-39 (1993).
Thompson, W.C. “Are Juries Competent
to Evaluate Statistical Evidence?” 52 l aw &
c onte m p . p r oB S . 9-41 (1989).
3. Irvin v. Dowd, 366 U.S. 717 (U.S. 1961).
4. Batson v. Kentucky, 476 U.S. 79 (U.S.
1986); overruled in part as stated in Coleman v.
Deloach, 1998 U.S. Dist. LEXIS 9615 (S.D. Ala.
May 7, 1998).
5. J.E.B. v. Ala. ex rel. T.B., 511 U.S. 127, 129
(U.S. 1994).
6. For example, Rule 703, Federal Rules of Evidence, allows experts to rely on evidence that
may be inadmissible at trial if such evidence is of

­
113

CHAPTER 8

a type normally relied on by experts in the pertinent field. That same rule, however, forbids the
expert from disclosing to the jury what the inadmissible evidence is.
7. Although the U.S. Supreme Court ruled in
Melendez-Diaz in 2009 (124 S. Ct. 2527 (2009))
that an analytical report cannot be entered into
evidence on its own without the supporting testimony of the analyst who performed the work,
there may still be instances in which a court will
allow another analyst or supervisor to testify in
lieu of the analyst who did the work.
8. See, for example, Rule 18.6(e) of the Arizona
Rules of Criminal Procedure.
9. National Center for State Courts, Jury Trial
Innovations (Munsterman, G.T., P. HannafordAgor and M. Whitehead, eds., 2d ed. 2006);
American Bar Association, Principles for Juries
and Jury Trials 91-124 (2005); Heuer, L., and S.
Penrod, “Juror Notetaking and Question Asking
During Trials,” 18 l aw & H um . B e Hav . 142 (1994);
Mott, N.L., “The Current Debate on Juror Questions: ‘To Ask or Not to Ask, That is the Question,’” Symposium: The Jury at a Crossroad:
The American Experience, 78 c Hicago -K e nt l.
r e v . 1099-1125 (2003); Heuer, L., and S. Penrod,
“Increasing Juror Participation in Trials Through
Note Taking and Question Asking,” 79 J udicatur e
256 (1996); Penrod, S., and L. Heuer, “Tweaking
Commonsense: Assessing Aids to Jury Decision
Making,” 3 p S ycHol . p uB . p ol ’ y & l . 259 (1997);
AOC State of New Jersey Jury Subcommittee,
Report on Pilot Project Allowing Jury Questions
(unpublished AOC report); Diamond, S., M. Rose
and B. Murphy, “Jurors’ Unanswered Questions,” (Spring) c our t r e v . 20-29 (2004), http://
aja.ncsc.dni.us/courtrv/cr-41-1/CR41-1Diamond.
pdf, and a law review version: Diamond, S.S.,
M.R. Rose, B. Murphy and S. Smith, “Juror
Questions During Trial: A Window Into Juror
Thinking,” 59 v ande r B ilt l. r e v . 1927 (2006);
Mize, G.E., P. Hannaford-Agor and N.L. Waters,
National Center for State Courts, The State-ofthe-States Survey of Jury Improvement Efforts:
A Compendium Report, pp. 34-7 (2007), available at www.ncsconline.org/D_Research/cjs/pdf/
SOSCompendiumFinal.pdf.
10. www.innocenceproject.org/Content/268.php.

­114

11. Parsons, T.J., and M.D. Coble, “Increasing
the Forensic Discrimination of Mitochondrial
DNA Testing Through Analysis of the Entire Mitochondrial DNA Genome,” 42(3) c r oatian m e d . J.
304, 304 (2001).
12. Wilson, M.R., M. Stoneking, M.M. Holland,
J.A. Dazinno and B. Budowle, “Guidelines for the
Use of Mitochondrial DNA Sequencing in Forensic Science,” 20 c r im e l aB d ig . 68–77 (1993).
13. See Fisher, C.L., et al., Mitochondrial DNA:
Today and Tomorrow, presented at e le ve ntH
a nnual i nt ’ l S ym poS ium on H um an i de ntification , at
1 (2000).
14. See Melton, T., and K. Nelson, “Forensic
Mitochondrial DNA Analysis: Two Years of Commercial Casework Experience in the United
States,” 42 c r oatian m e d . J. 298 (2001).
15. Id. at 300.
16. Id.
17. Kaestle, F.A., et al., “Database Limitations
on the Evidentiary Value of Forensic Mitochondrial DNA Evidence,” 43 a m . c r im . l. r e v . 53, 62
(2006).
18. FBI Laboratory DNA Unit II, Mitochondrial
DNA Sequencing Protocol (2004) [hereinafter FBI
MtDNA Protocol (2004)], at § 11.3.3.
19. Id.
20. Id.
21. Id. (citing Statement of Dr. M. Thomas P.
Gilbert, submitted in United States v. Chase,
D.C. Super. Ct. Crim. No. F-7330-99 (July 9,
2004) (reviewing protocols for all major mtDNA
testing laboratories and observing that “forensic
laboratories come to no consensus as to how to
interpret heteroplasmic sequences. ... [T]he interpretation guidelines vary when determining what
would be labeled as ‘inconclusive’ and what
would be labeled as an ‘exclusion.’”).
22. Technically, only the differences between
the sample and the reference (CRS/Anderson)
sequence are compared with the database
profiles. Isenberg, A.R., and J.M. Moore, “Mitochondrial DNA Analysis at the FBI Laboratory,”

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

1 f or e nS ic S ci. c om m . 1 (1999), available at www.
fbi.gov/hq/lab/fsc/backissu/july1999/dnalist.htm.
23. See, e.g., United States v. Porter, 618 A.2d
629 (D.C. 1992) (requiring expression of statistical significance of a DNA “match” as a prerequisite to admission); People v. Axell, 235 Cal. App.
3d 836 (2001) (same).
24. Bandelt, H.J., et al., “Problems in FBI MtDNA
Database,” 305 S cie nce 1402, 1403 (2004).
25. Id. SWGDAM is the Scientific Working Group
on DNA Analysis Methods.
26. Yao, Y.G., C.M. Bravi and H.J. Bandelt, “A
Call for MtDNA Data Quality Control in Forensic
Science,” 141 f or e nS ic S ci. i nt ’ l 1, 1 (2004).
27. Id. at 4.

interval will become narrower, indicating 95-percent confidence in a smaller range of possible
values for the frequency (Id. at 216).
36. Kaestle et al. (2006), supra note 17, at 64-65.
37. Phylogeography “is a field of study concerned
with the principles and processes governing the
geographic distributions of genealogical lineages,
especially those within and among closely related
species [and] deals with historical, phylogenetic
components of the spatial distributions of gene
lineages. In other words, time and space are the
jointly considered axes of phylogeography onto
which (ideally) are mapped particular gene genealogies of interest.” Avise, J.C., Phylogeography:
The History and Formation of Species (Harvard
University Press, 2000) at 3.

30. Id.

38. See, e.g., Mishmar, D., et al., “Natural
Selection Shaped Regional MtDNA Variation in
Humans,” 100 p r oc . n at ’ l a cad . S ci. 171 (Jan.
7, 2003) (“extensive global population studies
have shown that there are striking differences in
the nature of the mtDNAs found in different geographic regions”).

31. Budowle, B., et al., “Mitochondrial DNA
Regions HVI and HVII Population Data,” 103
f or e nS ic S ci. i nt ’ l 23, 25 (1999).

39. See Richards, M., et al., “In Search of Geographical Patterns in European Mitochondrial
DNA,” 71 a m . J. H um . g e ne t . 1168, 1170 (2002).

32. Id.

40. Although phylogenetic analysis — reconstructing genetic relationships within a population — has been conducted on many of the
SWGDAM racial sub-databases, such studies
show, at most, only that a particular database
accurately reflects most of the haplogroups that
exist in the relevant population, for example,
that the Caucasian database contains all major
haplogroups in the Caucasian population. Such
studies do not, however, take into account the
geographical distribution of the sequences within
the population and thus cannot be cited as evidence that a database accurately reflects the
frequency of a profile in a particular geographic
area. Only phylogeographic studies — those
that focus on the spectrum and area-specificity
of major haplogroups and the haplotypes within
them — can accurately determine true frequencies. See Rando, J.C., et al., “Phylogeographic
Patterns of MtDNA Reflecting the Colonization of
the Canary Islands,” 63 a nnalS H um . g e ne t . 413,
424 (1999) [hereinafter Rando et al. (1999)].

28. Bandelt, supra note 24.
29. Id.

33. FBI MtDNA Protocol (2004), supra note 18, at
§ 11.1.
34. Laboratories use a slightly different statistical
calculation when the sequence is not observed
in the database. See Holland, M.M., and T.J. Parsons, “Mitochondrial DNA Sequence Analysis:
Validation and Use for Forensic Casework,” 11
f or e nS ic S ci. r e v . 31-32 (1999).
35. A 95-percent confidence interval means
that, if a series of such margins of error were
constructed in estimating the frequency of the
sequence in the population, approximately 95
percent of them should include the true frequency of the sequence in the population. Alternatively stated, there is approximately a 5-percent
chance that the margin of error does not contain
the true frequency of the sequence in the population. See Witte, R.S., Statistics at 215 (2d ed.,
1985). As the sample size grows, the confidence

DNA

INITIATIVE

­
115

CHAPTER 8

41. See, e.g., Bamshad, M., et al., “Genetic
Evidence on the Origins of Indian Caste Populations,” 11 g e nom e r e S . 994 (2001) (discussing
economic and caste distinction); Dutta, R., et
al., “Patterns of Genetic Diversity at the Nine
Forensically Approved STR Loci in the Indian
Populations,” 74 H um . B iol . 33 (2002) (same);
Merriweather, D.A., et al., “Mitochondrial DNA
is an Indicator of Austronesian Influence in Island
Melanesia,” 110 a m . J. p HyS . a ntHr opol . 243
(1999) (linguistic distinctions); Rudan, P., et al.,
“Anthropological Research of Hvar Islanders,
Croatia — From Parish Registries to DNA Studies
in 33 Years,” 28 c olle gium a ntHr opologicum 321
(2004) (religious); Zhivotvsky, L.A., et al., “The
Forensic DNA Implications of Genetic Differentiation Between Endogamous Communities,”
119 f or e nS ic S ci. i nt ’ l 269 (2001) (no obvious
subdivision).
42. See, e.g., Balding, D., Weight-of-Evidence for
Forensic DNA Profiles 105-06 (2005) [hereinafter
Balding (2005)] (“[M]aternally-related individuals might be expected to be tightly clustered,
possibly on a fine geographical scale. Reports
of Fst estimates for mtDNA drawn from cosmopolitan European populations typically cite
low values, reflecting the fact that this population is reasonably well-mixed, as well as the
effects of high mtDNA mutation rates. However,
researchers rarely are able to focus on the fine
geographic scale that may be relevant in forensic
work, and there are some large Fst estimates
at this scale.”) (emphasis added); Brandstatter,
A., et al., “Mitochondrial DNA Control Region
Sequences From Nairobi (Kenya): Inferring Phylogenetic Parameters for the Establishment of
a Forensic Database,” 118 i nt ’ l J. l e gal m e d .
294 (2004) (describing new forensic database
containing sequences from Nairobi and finding
that there were significant differences in mtDNA
compositions of this new database and the
African-American SWGDAM database as well
as of published sequences from Sierra Leone,
Mozambique and United States); Forster et al.,
“Continental and Subcontinental Distributions of
mtDNA Control Region Types,” 116 i nt ’ l J. l e gal
m e d . 99-108 (2002); Kaestle, F.A., and K.A. Horsburgh, “Ancient DNA in Anthropology: Methods,
Applications, and Ethics,” 119(S35) a m . J. p HyS .
a ntHr opol . 92, 95 (2002) (“[M]itochondrial markers are also often geographically specific, and in
some cases are limited in distribution to a single

­116

tribe (private polymorphisms).”); Kittles, R.,
and S.O.Y. Keita, “Interpreting African Genetic
Diversity,” 16 a fr ican a r cHe ol . r e v . 87-91 (1999);
Pereira, L., et al., “Prehistoric and Historic Traces
in the mtDNA of Mozambique: Insights Into the
Bantu Expansions and the Slave Trade,” 65 a m .
J. H um . g e ne t . 439-458 (2001) [hereinafter Pereira
et al. (2001)]; [Rando et al. (1999), supra note 40,
at 413, 424; Salas, A., et al., “The African Diaspora: Mitochondrial DNA and the Atlantic Slave
Trade,” 74 a m . J. H um . g e ne t . 454-65 (2004)
[hereinafter Salas et al. (2004)]; Yao, Y.G., et al.,
“Phylogeographic Differentiation of Mitochondrial DNA in Han Chinese,” 70(3) a m . J. H um . g e ne t .
635, 649 (2002).
43. Richards, M.B., et al., “Phylogeography of
Mitochondrial DNA in Western Europe,” 62(3)
a nnalS H um . g e ne t . 241, 255 (1998) (discussing
J Haplogroup).
44. Id. at 254 (discussing J1b1 Haplogroup).
45. Rando et al. (1999), supra note 40, at 420,
424.
46. Pereira et al. (2001), supra note 42, at 439,
451-452. (“There remain a large number of
sequences from African haplogroups sampled
in the Americas and Europe for which no match
can be found in the current African database.
This may be due in part to the fact that the main
regions from where slaves were taken, such
as Angola and the Slave Coast, remain uncharacterized.”) (citation omitted). See also Lorenz,
J., et al., African-American Lineage Markers:
Determining the Geographic Source of mtDNA
and Y Chromosomes, presented at 73rd annual
meeting of the American Association of Physical Anthropologists, Tampa, FL, Apr. 15, 2004,
available at www.physanth.org (discussing study
suggesting that there is a large proportion of
unexamined, undocumented mtDNA variability
among individuals indigenous to sub-Saharan
Africa).
47. See, e.g., Eshleman, J., R.S. Malhi and D.G.
Smith, “Mitochondrial DNA Studies of Native
Americans: Conceptions and Misconceptions of
the Population Prehistoric of the Americas,” 12
e volution . a ntHr opol . 7-18 (2003) (noting that,
whereas Haplogroup X is found in low frequency
in Europe and Western Asia, the Native American

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

variant is significantly different, possessing mutation that distinguishes it from Old World
versions); Jorde, L.B., and S.P. Wooding,
“Genetic Variation, Classification, and ‘Race,’” 36
n atur e g e ne t . S28, S29 (Nov. 2004) (“[I]ndividuals tend to cluster according to their ancestry
or geographic origin.”); Malhi, R.S., et al., “The
Structure of Diversity Within New World Mitochondrial DNA Haplogroups: Implications for the
Prehistory of North America,” 70(4) AM. J. H um .
g e ne t . 905 (2002) (Native Americans have haplogroups whose frequencies vary greatly among
Canada, United States and Mexico); Parra, E.J.,
R.A. Kittles, et al., “Ancestral Proportions and
Admixture Dynamics in Geographically Defined
African Americans Living in South Carolina,” 114
a m . J. p HyS . a ntHr opol . 118 (2001) [hereinafter
Parra and Kittles (2001)]; Parra, E.J., A. Marcini,
et al., “Estimating African-American Admixture
Proportions by Use of Populations-Specific
Alleles,” 63 AM. J. H um . g e ne t . 1839 (1998)
[hereinafter Parra and Marcini (1998)]; Tishkoff,
S.A., and K.K. Kidd, “Implications of Biogeography of Human Populations for ‘Race’ and ‘Medicine,’” 36 n atur e g e ne t . S21, S26 (November
2004) (frequency of mtDNA haplogroups are
unevenly distributed within and among geographic regions and “knowledge of ethnicity (not just
broad geographic ancestry) and statistical tests
of substructure are important [to the] proper
design of case control association studies”).
Cf. Melton, T., et al., “Diversity and Heterogeneity in Mitochondrial DNA of North American
Populations,” 46 J. f or e nS ic S ci. 46 (2001) (while
arguing that the North American population is
homogeneous, this identifies, without exploring,
a population of Hispanics in Pennsylvania who
differed significantly from any other population in
the study).
48. Cann, R.L., M. Stoneking and A.C. Wilson,
“Mitochondrial DNA and Human Evolution,”
325 n atur e 31 (1987). See also Curtin, P.D., The
Atlantic Slave Trade: A Census (U. Wisc. Press,
1969; Lovejoy, 2d ed., 1994) [hereinafter Curtin
(1969)]. Curtin’s calculations were later refined
by David Northrup: Northrup, D., The Atlantic
Slave Trade (1994). See also Watson, E., et al.,
“MtDNA Sequence Diversity in Africa,” 59 a m . J.
H um . g e ne t . 437 (1996).
49. See, e.g., Melton, T., et al., “Extent of Heterogeneity in Mitochondrial DNA of sub-Saharan
African Populations,” 42 f or e nS ic S ci. i nt ’ l 582,

DNA

INITIATIVE

588-89 (1997) (finding numerous haplotypes with
SSO frequencies of greater than 10 percent in
particular African population and “substantial
subpopulation heterogeneity” in “continental
African populations”). The authors conclude that
“control region sequencing would be a good
alternative for forensic identifications in African
or African-derived populations where there is
uncertainty about whether subpopulations are
present, at least until further populations are
studied” (Id. at 589).
50. See generally, Salas et al. (2004), supra note
42, at 455-56.
51. Parra and Kittles (2001), supra note 47, at 19.
52. Morgan, P.D., Slave Counterpoint: Black Culture in the Eighteenth Century Chesapeake and
Lowcountry (1998) at 33-44.
53. Id. at 34-36.
54. Jackson, F.L., “Concerns and Priorities in
Genetic Studies: Insights from Recent AfricanAmerican Biohistory,” 27 S e ton H all l. r e v . 951,
961-62 (1997); Parra and Marcini (1998), supra
note 47, at 1839 (listing countries of Africa by
economic region). This very same resistance
makes African-Americans whose ancestors
come from the Gold Coast more susceptible to
sickle cell trait and sickle cell disease. Muniz, A.,
et al., “Sickle-Cell-Anemia and Beta-Gene Cluster
Haplotypes in Cuba,” 49 a m . J. H e m atol . 163
(1995); Pante-De Sousa, G., et al., “Betaglobin
Haplotypes Analysis in Afro-Brazilians from the
Amazon Region: Evidence for a Significant Gene
Flow from Atlantic West Africa,” 26 a nnalS H um .
B iol . 365 (1999).
55. Curtin (1969), supra note 48, at 83.
56. See generally, Grossman, J.R., Land of Hope:
Chicago, Black Southerners, and the Great Migration (1991).
57. Id. at 28-30.
58. Id. at 112-13 (migration from Mississippi delta
to Chicago); Lemann, N., The Promised Land:
The Great Black Migration and How It Changed
America (1991) (migration from the Carolinas and
Virginia up the East Coast) at 109-120.

­
117

CHAPTER 8

59. See www.census.gov/geo/www/mapGallery/
images/black.jpg (pictorial depiction of geographical distribution of African-Americans in United
States).
60. See Parra and Marcini (1998), supra note
47, at 1845-47; Parra and Kittles (2001), supra
note 47, at 19; Salas et al. (2004), supra note 42,
454-65.
61. See Parra and Marcini (1998), supra note 47,
at 1845-47; Chakraborty, R., “Gene Admixture in
Human Populations: Models and Predictions,” 29
y.B. p HyS . a ntHr opol . 1-43 (1986); McLean, Jr.,
D.C., et al., “Three Novel mtDNA Restriction Site
Polymorphisms Allow Exploration of Population
Affinities of African Americans,” 75 H um . B iol .
147 (2003).
62. See www.census.gov/geo/www/mapGallery/
images/americanindian.jpg (visual depiction of
heavy Native American clustering in the western part of the United States); Ogunwole, S.U.,
The American Indian and Alaska Native Population: 2000, at 4-6 (U.S. Census Bureau, February 2002) (noting that 43 percent of American
Indians lived in the West, 31 percent lived in the
South, 17 percent lived in the Midwest, and 9
percent lived in the Northeast).
63. Parra and Marcini (1998), supra note 47, at
1845. The admixture study reports two results
from Philadelphia, based on two independent
sample sets taken from patients in two separate
hypertension studies. These sample sets exhibited significant differences in their percentage of
admixture (Id.). Thus, even within a single city,
different groups of African-Americans display
significantly different mtDNA profiles.
64. Id. at 1845-47.
65. See Bonilla, C., M.D. Shriver, et al., “Admixture in the Hispanics of the San Luis Valley,
Colorado and Its Implications for Complex Trait
Gene Mapping,” 68 a nnalS H um . g e ne t . 139, 140
(2004) (the term Hispanic applies to individuals
from several continents with “diverse cultural
features and genetic backgrounds”).
66. See id. (reporting differences in admixture
among Puerto Rican, Cuban and Mexican
groups as well as within smaller region of San
Luis Valley); Irwin, J., et al., “Development and

­118

Expansion of High-Quality Control Region Databases to Improve Forensic MtDNA Evidence
Interpretation,” 1(2) f or e nS ic S ci. i nt ’ l : g e ne ticS
154 (2007) (showing significant regional differences between “Hispanic” populations).
67. Malhi, R.S., et al., “Native American mtDNA
Prehistory in the American Southwest,” 120 a m .
J. p HyS . a ntHr opol . 108, 113 (2003) [hereinafter
Malhi et al. (2003)].
68. Id. In addition, the Navajo and Apache tribes
are not representative of the variation present in
haplotypes/haplogroups among all North American Native Americans. Tribal groups in the United
States share few haplotypes. See Malhi et al.
(2002), supra note 47, at 914, Table 2 (estimating
sharing at approximately 29 percent).
69. Malhi et al. (2003), supra note 67, at 121-22.
70. The primary published analysis of this database concerns only the Chinese samples, and
although the analysis suggests that the frequencies of the haplogroups in the data set are similar
to those in another Han Chinese dataset of 263
individuals, the authors’ data reveal significant
differences in almost all cases. Allard and Wilson
et al., “Control Region Sequences for East Asian
Individuals in the Scientific Working Groups on
DNA Analysis Methods Forensic mtDNA Data
Set,” 6 l e gal m e d . L11, L18 Fig. 2 (2004). Other
studies also show significant genetic variation
among and within Asian populations. See, e.g.,
Kivisild and Tolk et al., “The Emerging Limbs and
Twigs of the East Asian mtDNA Tree,” 19 m ol .
B iol . e vol . 1737 (2002) (other Asian populations
not represented in the SWGDAM East Asian
database have significantly different frequencies
of mtDNA haplogroups than those in the database); Melton, T., and M. Stoneking, “Extent of
Heterogeneity in Mitochondrial DNA of Ethnic
Asian Populations,” 41 J. f or e nS ic S ci. 591-602
(1996) (same); Yao et al. (2002), supra note 42, at
nn. 76-78 and accompanying text (combining all
Han Chinese would be inappropriate).
71. See Reeves, T.J., and C.E. Bennett. We the
People: Asians in the United States, Pub. No.
CENSR-17, Census Bureau, U.S. Department of
Commerce, at 1 and Table 1 (2004), available at
www.census.gov/prod/2004pubs/censr-17.pdf
(listing major Asian groups in the United States,

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

many of which are not included in SWGDAM
Asian databases).
72. Id. at 4 and Fig. 1.
73. Yao et al. (2002), supra note 42, at 635.
74. See id. at 649 (“The comparison of the
regional Han mtDNA samples revealed an obvious geographic differentiation in the Han Chinese, as shown by the haplogroups-frequency
profiles. ... Hence, the grouping of different Han
populations into just “Southern Han” and “Northern Han” or the use of one or two Han regional
populations to stand for all Han Chinese ... does
not appropriately reflect the genetic structure of
the Han.”) (citations omitted).
75. See Branicki, W., K. Kalista, et al., “Distribution of mtDNA Haplogroups in a Population
Sample from Poland,” 50 J. f or e nS ic S ci. 732,
733 (2005) (H Haplogroup observed in 37.8 percent of samples in population from southern
Poland); Dubut, V., and L. Chollet, “MtDNA Polymorphisms in Five French Groups: Importance
of Regional Sampling,” 12 e ur . J. H um . g e ne t .
293-300 (2004) (within France alone, frequency
of H varies between 35 percent and 50 percent in two separate communities in Brittany);
Gonzalez, A.M., and A. Brehm, “Mitochondrial
DNA Affinities at the Atlantic Fringe of Europe,”
120 J. p HyS . a ntHr opol . 391-404 (26.3 percent
in Norway, 34 percent in England, 36.4 percent
in Northern Germany, 38.5 percent in France,
and 42.2 percent in Galicia); Malyarchuk and
Grzybowski, “Mitochondrial DNA Variability in
Bosnians and Slovenians,” 67 a nnalS H um . g e ne t .
412-25 (2003) (frequency of H Haplogroup is 24
percent in Finland, 26.8 percent in Scotland, and
45 percent in Poland).
76. See also Pereira, L., et al., “Evaluating the
Forensic Informativeness of mtDNA Haplogroup
H Sub-Typing on a Eurasian Scale,” 159(1) f or e n S ic S ci . i nt ’ l 43, 50 (2006) (use of SNPs to more
closely examine haplogroups demonstrates significant interrelatedness below the haplogroup
level and suggests that “phylogenetic dissection
of mtDNA haplogroups is revealing gradients previously hidden on the Eurasian scale”).
77. Vaughn v. State, 646 S.E.2d 212, 214 (Ga.
2007).

DNA

INITIATIVE

78. See, e.g., id. at 215 (“The conflicting expert
opinions on the [mtDNA] test results go to
the weight rather than the admissibility of the
testimony”); People v. Ko, 757 N.Y.S.2d 561, 563
(App. Div. 2003) (“mitochondrial DNA analysis
has been found reliable by the relevant scientific community; issues regarding contamination
go to the weight to be given such evidence”);
People v. Ko, 757 N.Y.S.2d 561: State v. Pappas, 776 A.2d 1091 (Conn. 2001) (holding that
“issues regarding contamination are important
and may bear on the weight of mtDNA evidence
in a particular case, but that those issues do not
undermine the admissibility of the results of the
mtDNA sequencing process”) (internal citation
omitted).
79. Wagner v. State, 864 A.2d 1037 (Md. App.
2005) (finding mtDNA “inclusion” evidence
properly admitted); State v. Council, 515 S.E.2d
508, 518 (1999) (finding the underlying science
of mtDNA reliable and “inclusion” evidence was
properly admitted); State v. Council, 515 S.E.2d
508: State v. Underwood, 518 S.E.2d 231, 240
(N.C. 1999) (holding that mtDNA testing is sufficiently reliable to warrant its admissibility into
evidence); State v. Scott, 33 S.W.3d 746, 756
(Tenn. 2000) (holding that mtDNA was properly admitted without an admissibility hearing);
Adams v. State, 794 So.2d 1049, 1064 (Miss.
App. 2001) (holding that science of mtDNA
sequencing is adequately proven); State v. Pappas, 776 A.2d 1091, 1110 (Conn. 2001) (finding
no error in admitting mtDNA evidence); People v.
Holtzer, 660 N.W.2d 405, 411 (Mich. 2003) (holding that use of mtDNA for identification of the
defendant is admissible under the test for novel
scientific evidence); Magaletti v. State, 847 So.2d
523, 528 (Fla. Dist. Ct. App. 2003) (holding that
use of mtDNA analysis to prove identity satisfied
Frye); People v. Ko, 757 N.Y.S.2d 561, 563 (2003)
(upholding the trial court’s admission of mtDNA
evidence). Admission of mtDNA evidence also
has been upheld in a number of unpublished
appellate decisions. People v. Ko, 757 N.Y.S.2d
561: See State v. Smith, 100 Wash. App. 1064,
2000 WL 688180 (Wash. Ct. App. 2000); State v.
Ware, 1999 WL 233592 (Tenn. Crim. App. 1999);
Sheckells v. Texas, 2001 WL 1178828 (Tex. Ct.
App. 2001).
80. United States v. Coleman, 202 F. Supp. 2d
962, 970-71 (E.D. Mo. 2002) (denying the defendant’s motion to exclude mtDNA and finding it

­
119

CHAPTER 8

reliable, helpful to the jury, and not unduly
prejudicial).
81. Butler, J.M., Forensic DNA Typing (2d ed.,
2005) at 214.
82. Id. at 213-14.
83. See e.g., Bonilla, C., et al., “Admixture in
the Hispanics of the San Luis Valley, Colorado,
and Its Implications for Complex Trait Genemapping,” 68 a nn . H um . g e ne t . 139 (2004) (reporting
wide variation in genetic profiles of various ethnic groups are falling under the cultural rubric of
“Hispanic”); Hedman, M., et al., “Analysis of 16 Y
STR Loci in the Finnish Population Reveals a Local
Reduction in the Diversity of Male Lineages,” 142
f or e nS ic S ci. int ’ l 37 (2004) (a particular 16-loci
Y-STR profile is shared by 13 percent of the Finnish population); Roewer, L., et al., “Online Reference Database of European Y-Chromosomal
Short Tandem Repeat (STR) Haplotypes,” 118
f or e nS ic S ci. c om m . 106 (2001) (the most frequent minimal haplotype is observed in 3 percent
of the continental European population); Weale,
M.E., et al., “Armenian Y Chromosome Haplotypes Reveal Strong Regional Structure Within an
Single Ethno-National Group,” 109 H um . g e ne t .
659 (2001) (finding significant regional stratification of Y-STR DNA profiles and observing that
the London Armenian subsample was insufficient to describe genetic variation); Zarrabeitia,
M.T., et al., “Significance of Micro-Geographical
Population Structure in Forensic Cases,” 117
i nt ’ l J. l e gal m e d . 302 (2003) (studying Ychromosome profiles in Cantabria region of Spain
and finding that the substantial overstatement
of evidential strength frequently results from
the use of population databases collected on
too broad a geographical scale); Zerjal, T., et al.,
“The Genetic Legacy of the Mongols,” 72 a m . J.
H um . g e ne t . 717 (2003) (8 percent of 2,100 males
from Central Asia region closely matching males
from an area of Genghis Khan’s former Mongol
Empire had unique Y-chromosome lineage).
84. Buckleton, J., C.M. Triggs and S.J. Walsh,
Forensic DNA Evidence Interpretation (2005) at
324.
85. Id.
86. Id.

­120

87. See, e.g., Cordova, C.B., The Salvadoran
Americans 69 (2005) (“Since 1979, the influx
of Salvadoran immigrants to the United States
has risen at a high rate.”); Latinas in the United
States: A Historical Encyclopedia 135 (Ruiz, V.L.,
and V.S. Korrol, eds., 2006) (“Central American immigration increased exponentially [in the
1980s], quintupling the Salvadoran population [in
the United States].”).
88. See Price, M., et al., “The World Settles In:
Washington, DC, As an Immigrant Gateway,”
26 u r B an g e og . 61, 63 (2005) (“Unlike the more
established urban immigrant destinations, the
District of Columbia is not built upon a rich history of immigration and has only recently become
an immigrant destination. Thus there are few
historically ethnic immigrant neighborhoods or
enclaves.”); see also, The Rise of New Immigrant Gateways (Brookings Institute, February
2004).
89. See El Salvador: A Country Study (Haggerty,
R.A., ed., 1990) at 67 (“observers have estimated that much of the Salvadoran population in the
1980s could be said to possess an Indian racial
background”).
90. See, e.g., Bonilla, C., et al., “Ancestral Proportions and Their Association with Skin Pigmentation and Bone Mineral Density in Puerto Rican
Women from New York City,” 115 H um . g e ne t .
57 (2004); Buentello-Malo, L., et al., “Genetic
Structure of Seven Mexican Indigenous Populations Based on Five Polymarker Loci,” 15 a m . J.
H um . B iol . 23 (2003).
91. See Cordova (2005), supra note 87, at 78
(“This population [including that which immigrated to Washington, D.C.] is mainly rural, or
coming from provincial Salvadoran cities and
towns.”); Id. (“large numbers of persons from
the eastern part of El Salvador relocated in metropolitan centers in the East Coast” of the United
States, including Washington, DC).
92. Id. (“Large numbers of urban dwellers and
those with more education have relocated in
the Los Angeles and San Francisco metropolitan
areas. In San Francisco, for example, many people are from San Salvador, Sonsonate and other
major [western] provincial cities.”)

DNA

INITIATIVE

DNA BAsiCs: TRiAl issuEs

93. Id. at 78 (“These new immigrants arrived in
the United States as a result of already established ethnic and family networks.”).
94. See Curtis v. State, 205 S.W.3d 656 (Tex.
App. 2006) (finding Y-STR “inclusion” evidence
sufficiently reliable under Daubert); State v.
Unsworth, No. L-03-1189, No. L-04-1165 (Ohio
App. Sept. 2, 2005) (admitting Y-STR evidence
under Daubert); State v. Unsworth, State v.
Sanders, State v. Russell, State v. Avila, State
v. Temple-State v. Sanders, No. CR-2000 2900
(Ariz. Super. Ct. Dec. 16, 2003) (admitting Y-STR
evidence but limiting statistical characterization
to number of occurrences of profile in database);
State v. Russell, No. 05-1-02485-2 (Wa. Super.
Ct. Jan. 2006) (finding Y-STR admissible under
Frye, with no need for a new admissibility hearing); State v. Avila, No. 02CF1862 (Ca. Super.
Ct. Feb. 17, 2005) (finding Y-STR from Y-PLEX
kit and statistics based on ReliaGene database
are admissible under Frye); State v. Temple, No.
02040491 (Minn. Dist. Ct. Apr. 14, 2005) (finding
Y-STR admissible under Frye); State v. Polizzi,
924 So.2d 303 (La. App. 2006) (admitting Y-STR
without a challenge); Shabazz v. State, 592
S.E.2d 876 (Ga. App. 2004) (same).
95. Butler, supra note 81, at 270.
96. Buckleton, J., C.M. Triggs and S.J. Walsh,
eds., Forensic DNA Evidence Interpretation,
Boca Raton, FL: CRC Press, 2005.
97. NRC I and NRC II: National Research Council,
DNA Technology in Forensic Science, Washington, DC: National Academy Press, 1992; National
Research Council, The Evaluation of Forensic
DNA Evidence, Washington, DC: National Academy Press, 1996.

DNA

INITIATIVE

98. See also, What Every Law Enforcement
Officer Should Know About DNA Evidence: First
Responding Officers, http://dna.gov/training/
letraining.
99. Saks and Kohler, “The Coming Paradigm
Shift in Forensic Identification Science,” 309
S cie nce 892 (August 2005).
100. United States v. Morrow, 374 F. Supp. 2d
51, 66 (D.D.C. 2005); National Research Council,
The Evaluation of Forensic DNA Evidence, Washington, DC: National Academy Press, 1996,
p. 133, http://books.nap.edu/openbook.php?
record_id=5141&page=133.
101. Decisional law in this area is mixed. See,
e.g., State v. Seager, 2001 Iowa App. LEXIS 671
(Iowa Ct. App. 2001) (collecting cases); compare
Hayes v. State, 660 So. 2d 257 (Fla. 1995) and
United States v. Mason, 59 M.J. 416 (U.S.C.A.F.
2004) (error for prosecutor who argued defense
had opportunity to test DNA evidence) with
Teoume-Lessane v. United States, 931 A.2d 478
(D.C. 2007) (not improper burden-shifting for
prosecutor to ask witness about defense’s ability
to test DNA evidence). A particular argument, in
language and tone, may be subject to challenge
on this ground, especially where the comment
may be read by the jury as highlighting the defendant’s failure to testify. See, e.g., United States
v. Triplett, 195 F.3d 990, 995 (8th Cir. 1999).
102. See Griffin v. California, 380 U.S. 609, 614
(1965) (“we … hold that the Fifth Amendment, in
its direct application to the Federal Government
… forbids … comment by the prosecution on the
accused’s silence”).

­
121

CHAPTER 9

Delayed Prosecutions, Cold Case Hits and CODIS
Section 1: Statute of Limitations
Defenses

which DNA evidence exists and has been
preserved.6

Statute of limitations legislation serves a number
of purposes:

Section 2: John Doe Warrants

[T]he applicable statute of limitations ... is ...
the primary guarantee against bringing overly stale criminal charges. Such statutes represent legislative assessments of relative
interests of the [s]tate and the defendant in
administering and receiving justice; they are
made for the repose of society and the protection of those who may [during the limitation] ... have lost their means of defence.1
From the defendant’s vantage point, there
is particular “concern that the passage of
time has eroded memories or made witnesses or other evidence unavailable.”2
The following principles of law are not in dispute:
■■

Once the period for commencing prosecution
has expired, it cannot be retroactively extended by new legislation.3

■■

This is true even in cases where DNA evidence conclusively establishes identity.4

■■

Conversely, when a legislature extends the
statute of limitations for a particular criminal
act before it expires, the extended period
applies and no statute of limitations defense
applies.5

The advent and success of using DNA to prove
identity — particularly in sex crimes with biological material — have led to legislation changing
the time period in which specified crimes may be
prosecuted. In some instances, the time period
has been lengthened or eliminated entirely. An
extended period has been granted in cases in

DNA

INITIATIVE

Typically, the period of limitations is tolled when
a charging document with some information
about the perpetrator’s identity has been properly filed. “John Doe” warrants — warrants
without a known name but with some identifying
information — have begun to be used, particularly in DNA cases.
The first issue is whether John Doe DNA warrants satisfy the “particularity” requirement of
the Fourth Amendment or parallel provisions
of state constitutions. Generic descriptions of
suspects generally do not meet this standard.7
However, courts that have considered the issue
to date have found that John Doe warrants with
a numeric DNA profile as the identifier meet the
Fourth Amendment standard.8
A separate argument contends that a warrant
should give notice to the perpetrator so that he
or she can gather evidence and prepare to meet
the charges. Clearly, a DNA-profile warrant does
not give notice to the average citizen. However,
the one court to consider this claim to date has
rejected it.9 This type of claim would apply only in
states where the statute of limitations has been
extended but not eliminated; there would be
no claim of entitlement to such notice in states
where the legislature has abolished a particular
period for commencing prosecution.

Section 3: Due Process
Regardless of whether the limitations period has
been extended or abolished, delayed prosecution
may raise due process concerns if the right to

123
­


CHAPTER 9

present a defense has been severely compromised. The U.S. Supreme Court has explained
that the Fifth Amendment requires the dismissal
of an indictment — even if it is brought within
the statute of limitations — if the defendant can
prove that the government’s delay was a deliberate device to gain an advantage over him and
that it caused him actual prejudice in presenting
his defense.10

and compare qualifying DNA profiles on the
national level. Profiles deemed “allowable” by
NDIS are then searched against profiles from
all other SDIS participating labs accepted at
the national level. As of August 2010, NDIS
had more than 8.7 million offender profiles
and more than 330,000 casework profiles.14
■■

SDIS — the State DNA Index System —
allows laboratories within each state to
exchange DNA profiles. Each state has a
single statewide databank — SDIS. The FBI
serves as the SDIS lab for the District of
Columbia. The U.S. Army Crime Lab is also an
SDIS lab. Each SDIS Administrator acts as the
gatekeeper for determining the acceptability,
based on that state’s guidelines, of profiles
submitted by each of the state’s LDIS labs.
Profiles accepted by the SDIS Administrator
can be searched against those entered by
other LDIS labs in the same state. Profiles
accepted by an SDIS lab will also be searched
against the convicted offender and arrestee
(when applicable) profiles entered by the SDIS
lab. SDIS custo-dians can share their data with
the national CODIS community by forwarding
it for consideration for inclusion in NDIS.

■■

LDIS — the Local DNA Index System — is
the databank where regional, county and
municipal labs within a state enter their profiles. Bench-level DNA examiners, or the lab’s
designee, use CODIS software to enter DNA
evidence profiles into LDIS, where they are
searched against other profiles that have been
entered previously by their lab. Local labs can
then forward their profiles to the state level
for consideration for upload. Local labs must
go through their SDIS lab to get profiles into
the national level of CODIS.

The difficulty in applying this test is twofold.
First, it requires proof of the prosecution’s ill
motive in delaying, unless state law is more solicitous.11 Second, the prejudice must be substantial.12 Nonetheless, it is an issue that warrants
examination in any case where there is a significant gap between commission of the offense
and commencement of actual prosecution.

Section 4: The Databank Hit Case
Overview of the CODIS DNA databanks
In 1990, the FBI Laboratory began a pilot project
called CODIS, creating proprietary software that
enabled and continues to enable federal, state
and local laboratories to electronically upload,
exchange and compare DNA profiles.
The Federal DNA Identification Act was enacted
as part of the Violent Crime Control and Law
Enforcement Act of 1995 (Public Law No. 103322). This law authorized the FBI to establish a
national DNA index for law enforcement. Since
then, federal and state governments have invested significant resources toward developing and
maintaining a national databank system. NDIS
became fully operational in October 1998.
CODIS users predominantly access two indexes:
the forensic index and the offender index.13 The
forensic index contains DNA profiles from crime
scene evidence. The offender index contains
DNA profiles of individuals who have been convicted of offenses defined by state or federal
law. The FBI maintains the CODIS databank.
CODIS has three levels:
■■

124

NDIS — the National DNA Index System — is
the highest level in the CODIS hierarchy. It
enables participating labs to upload, exchange

The three-tiered system allows state and local
agencies to operate their individual databases
within the confines of state laws, which vary by
jurisdiction. The exchange of information within
this secure system is controlled by and strictly
limited to law enforcement.
CODIS allows for the entry of qualifying DNA
profiles into indexes based on specimen categories. The most commonly used specimen categories are as follows:
■■

Convicted offender: DNA profiles of people
convicted of a crime.

DNA

INITIATIVE

DElAyED PRosECuTions AnD ColD CAsE HiTs

■■

Forensic: DNA profiles developed from crime
scene evidence.

■■

Arrestee: DNA profiles of arrested persons
(if state law permits the collection of arrestee
samples).

■■

Missing persons: DNA profiles from missing
persons — either known or deduced to be
known profiles from missing persons.

■■

Unidentified humans: DNA profiles from
recovered unidentified human remains (UHR)
as well as from humans who are unable or
unwilling to identify themselves.

■■

Biological relatives of missing persons:
DNA profiles voluntarily contributed by relatives of missing persons.

Other databank indexes exist (such as those that
contain RFLP profiles), and the ability to enter
mtDNA and Y-STR data has been added for certain specimen indexes. Federal and state laws
govern access, disclosure, compatibility, expunction and penalties for unauthorized disclosure of
information contained within CODIS.15
The DNA Identification Act of 1994, which established NDIS, also created the DNA Advisory
Board (DAB) to develop standards for quality
assurance. The board’s work culminated with
the promulgation of the first set of standards
document for the forensic DNA casework analysis community, which became effective nationally on October 1, 1998, issued by the FBI director.
These standards superseded the existing
TWGDAM Guidelines that had previously been
used as the guiding document by forensic DNA
labs. A second set of standards for convicted
offender databasing laboratories, which became
effective on April 1, 1999, was issued by the
DAB before the group disbanded on March 9,
2000. Currently, the responsibility for maintaining
the Quality Assurance Standards (QAS) documents falls to the director of the FBI. Recommendations for updates are provided by the
Scientific Working Group on DNA Analysis Methods (SWGDAM).16
To participate in NDIS, states must sign a Memorandum of Understanding verifying that the submitting laboratory is in compliance with the FBI’s
quality assurance standards.

DNA

INITIATIVE

Forensic DNA databanks were originally limited
to samples only from adults convicted of felony
sex offenses and a few other violent crimes.
Databanks have now been expanded to include
many other offenses as well as other classes of
offenders. All 50 states, the District of Columbia,
and all federal jurisdictions now require certain
classes of convicted offenders to provide a biological sample for entry into a DNA database.
Each jurisdiction’s statute determines whether a
person convicted of an offense will be required
to submit a biological sample for inclusion in a
DNA database. (For more information, see http://
forensic.dna.gov/module9/1/.) The trend is clearly
moving toward including larger categories of
people, including those with misdemeanor convictions, juveniles and arrestees.17
CODIS contains limited information, such as a
specimen identifier, the sponsoring laboratory’s
identifier, the initials or name of DNA personnel
associated with the analysis, and the actual DNA
profile. Depending on lab protocol, the specimen
identifier of profiles submitted to the forensic
(casework) index may identify the type of bodily
fluid, whether the source is known, and/or
whether the entered profile was deduced from
results of mixed-sample DNA typing. CODIS
does not store criminal history information or the
names of convicted offenders/arrestees.
When CODIS software recognizes the same
DNA profile in the forensic and offender indexes,
it identifies the two profiles as a match. These
matches are commonly referred to as “hits.”
Qualified personnel from both involved labs then
analyze the reported match to either validate or
refute it. This critical review of all matches is
standard operating procedure and is used to
ensure that a match produced by a search of the
databank “makes sense.” With a hit generated
by a search of CODIS that involves a 13-loci
match between an offender profile and a singlesource evidence profile, the review process is
fairly straightforward. Once both labs have
agreed that the profiles do indeed match, the
convicted offender lab will then research which
offender corresponds to the specimen identifier
in its system and will pull the corresponding sample and rerun it to confirm that the archived sample bearing the offender’s name generates the
same profile as the one entered into CODIS for
that individual. This quality check is to ensure

­
125

CHAPTER 9

that sample results were not inadvertently
switched during analysis or data entry. Once the
profile has been confirmed in this manner, the
convicted offender lab will subsequently provide
basic information regarding the offender, such as
name, available Department of Corrections information, and recorded date of birth, race and sex
to the casework lab. The casework sample lab
will then issue a hit report to the investigating
agency to notify it of the databank match. This
report typically requests submission of a newly
obtained buccal sample from the identified
offender to the casework lab as another quality
check to ensure that a DNA profile obtained from
the offender does indeed match the profile generated for the evidence profile. This report should
also specify that the hit information is only
intended to provide potential investigative leads
that must be pursued by the investigating agency. If subsequent investigation supports that the
CODIS match is meaningful, this can be used as
the basis for probable cause to obtain the
requested biological sample from the offender.
There are times, however, when the DNA profile
generated from crime scene evidence that has
been entered into CODIS is a mixture of more
than one person’s DNA. In those cases, the analysts will still critically compare the profiles to see
if the offender’s profile is included as part of the
mixed DNA casework profile. It is not uncommon in these circumstances for the analysts
to dismiss a match proposed by CODIS as not
“making sense” on the basis of analytical data.
When this occurs, unless agency policy states
otherwise, no hit report will be issued by the
casework lab; however, all information regarding
the comparison and disposition of the hit will be
maintained in the corresponding case file. When
the labs determine, on the basis of their review,
that the analytical data support the hit, a similar
process to the one noted above is followed by
the offender lab to research, confirm and share
offender information with the casework lab.
When a DNA profile in the forensic index matches another profile in the forensic index, crime
scenes can be linked together. CODIS hits involving two casework profiles will still go through a
verification process. If both labs are in agreement
that the profiles match, both casework labs will
typically provide hit reports to the corresponding
investigating agencies. These hits enable investigators to identify repeat offenders, coordinate

126

investigations and share leads, even across multiple jurisdictions.

Introduction: The hypothetical databank
hit case
A woman alleges that she was raped, but she
cannot make an identification and the police do
not have a suspect. Semen found in her vagina is
typed for a DNA profile, and the profile is developed and entered into the state’s DNA databank.
It is compared with the profiles in the convicted
offender databank, and there is a match with the
defendant. The police use this hit as probable
cause to ultimately take the client’s DNA sample,
which is then tested and compared with the evidence sample. This may result in prosecution but
could result in a delayed prosecution when the
following occurs:
■■

The testing by the lab is conducted well after
the alleged incident occurs.

■■

The testing is conducted and the databank
match occurs, but the suspect is not available
to provide a sample for direct comparison with
the evidence profile until later.

■■

The databank hit occurs in reasonably close
proximity to the alleged incident; however, it
takes a while for the government to build a
case for prosecution.

■■

The databank hit occurs in reasonably close
proximity to the alleged incident; however,
other pending prosecutions against the defendant delay ability of the prosecution to initiate
the case at hand.

This section covers some of the concerns and
opportunities for defense attorneys dealing with
these increasingly common “cold hit” cases.

How to approach a CODIS or cold hit case:
The basics
A “cold hit” case is generally like a “normal”
DNA case, except that the government may have
little to go on, other than the cold hit. Defense
counsel can still use the typical defense theories
that do not involve challenging the DNA evidence, such as consent, or fabrication or planting of evidence. Of course, sometimes such a
defense is not the best option. In those cases,

DNA

INITIATIVE

DElAyED PRosECuTions AnD ColD CAsE HiTs

counsel may want to challenge the DNA match
evidence under a general challenge to the reliability of the match, a specific third-party perpetrator
theory (involving an unknown person or a relative), or a contamination or lab mix-up theory.

Section 5: Review the Match
Report Carefully

Reviewing discovery information is critical. The
defense should review the same discovery
information it would review in other DNA cases
— evidence reports, physical evidence recovery,
sex assault kit collection and hospital records,
and police reports. Crime lab records can be
somewhat different in a cold hit case. Counsel
must review lab reports on the chain of custody
and analysis of the evidence sample, the client’s
known sample, and any other samples that were
compared. Counsel should also ensure that they
obtain copies of all match reports generated as a
result of previous searches of the DNA databank
for the profile in the case.

■■

The client’s DNA is already in a databank.
When the lab enters the forensic casework
profile into the databank, the profile matches
the client’s profile.

■■

A casework profile attributed to the client was
previously entered into the databank (from
a separate case) and is found to match the
newly entered casework profile for which
there is no suspect.

■■

Initial upload of the casework or offender profile does not result in a databank hit. However,
at some later point, the upload of either an
offender profile or another casework profile
results in a hit.

The defense’s basic investigation — for example,
of the client’s alibi, the complaining witness, or
evidence of a third-party perpetrator — should
proceed as in any other case. In addition, counsel
should consider the client’s relatives, especially
siblings, and any potential unknown relatives as
third-party perpetrators. Interview all lab personnel involved in the case and thoroughly review
the match report and other lab documents.

■■

There is a one-time keyboard search for the
client’s DNA profile in the databank that
results in a hit.

■■

A databank search results in a hit matching
the suspected perpetrator or the individual
convicted of the crime — from which the profile was generated when the offender’s profile
is uploaded into CODIS — referred to as a
benchwork match.

A cold hit case can seem intimidating. It is
important to remember all of the other types of
evidence that a cold hit case tends to lack. Generally, a person is identified on the basis of a cold
hit precisely because the police lack a suspect.
Often, the prosecution has no eyewitness identification, and any post-cold-hit identifications are
suspect — assuming the witness was unable to
give a detailed and accurate description before
the defendant was matched through a databank
hit. The prosecution may lack other types of
forensic information, such as fingerprints. The
client may not be a “usual suspect,” such as
a significant other or close associate. Defense
counsel probably will not have to deal with a confession and can criticize the police investigation
for not discovering anything of value. The questioned cold hit will stand alone, uncorroborated.

If the match is to a suspect profile generated
and entered by the same LDIS lab, be sure to
compare when the client’s DNA was originally
entered into the databank and when the evidence profile was entered. Was the evidence
profile generated before the client’s profile was
generated for any case? Or was it generated
before the client’s profile was generated for the
present case? The development of the evidence
profile before the client’s profile minimizes the
risk that the evidence was mistyped or crosscontaminated.

For more information on cold case resources,
visit: http://ncstl.org/education/Cold%20
Case%20Toolkit.

DNA

INITIATIVE

There are five basic types of DNA databank hits:

As in other DNA cases, check which loci match;
be especially careful when the evidence profile
is a mixture. Check the match report to see how
many loci match between the client’s known
sample and the evidence sample. The client can
be tested at more than 13 locations, yet evidence samples can contain only 13 — or sometimes fewer — matching loci.

­
127

CHAPTER 9

Figure out which databanks were searched:
Was it an LDIS, an SDIS, or an NDIS hit? Look
at how many samples other than the client’s
were searched, especially if the match did not
result from a search of NDIS. Compare that number with how many samples would have been
searched had the government searched against
their state or other state databanks and/or the
national databank. This can be done by obtaining
the size of relevant databanks through a discovery request or Internet searches. Conversely,
because local databanks may have less stringent
requirements for profile inclusion or can house
suspect profiles that cannot be uploaded to
NDIS, they may contain profiles not included in
NDIS. Was the most local — and, arguably, most
relevant — databank searched?
It is also critical to determine how the government came to possess the defense client’s DNA.
Through the match report or additional discovery,
find out when the client’s DNA profile was first
entered into the databank. Samples are usually
entered at the SDIS level because a person was
arrested or convicted. Sometimes, samples are
included in LDIS and/or SDIS because suspect
profiles are allowable, a person “voluntarily”
supplied his or her DNA to law enforcement (as
in a DNA dragnet), or law enforcement surreptitiously tested an item (like a cigarette butt) for a
person’s DNA, which was then entered into the
local or state databank. Alternatively, in a rare circumstance, the client (a) may have been a prior
victim of a crime whose known sample required
DNA testing, (b) was the victim of a crime who
contributed DNA to a mixed profile that could
not be deconvoluted, (c) provided an elimination
sample to exclude that person as a possible contributor in another case, or (d) their profile was
entered in a local lab databank that allows entry
of victim profiles.

Probable cause and unreasonable
searches and seizures
Do not assume that a CODIS hit creates probable cause to arrest the client or take his or her
DNA. Look for what the report, issued by the
lab providing notification of the databank hit,
states or does not mention. If the report states
only that there is “consistency” between the
profiles or that the client cannot be excluded,
then defense counsel can challenge the claim

128

of probable cause.18 For example, in a Chicago
case, police were told of a DNA hit, but the suspect was in prison at the time of the crime. The
police later learned that the hit was only a partial
match; however, the lab did not mention this in
its paperwork.19 A police source recognized that
this type of error could lead to probable cause
challenges.20
It is important to keep in mind, however, that
DNA databank hits must always be confirmed by
collection and analysis of a new known sample
from the named individual and are only intended
to provide potential investigative leads that must
be pursued by the investigating agency. Statements similar to the following are typically provided in laboratory hit notification reports:
This information is provided only as an
investigative lead, and any possible connection or involvement of this individual to the
case must be determined through further
investigation. In order to complete the direct
DNA profile comparison, a buccal (cheek)
sample from [the offender whose case profile produced a hit] must be submitted to
the Laboratory.
Consistency between profiles does not mean
that the defendant is the only possible source of
the evidence sample, or even a probable source.
Without an appropriate measure of the match’s
statistical significance, the court may not be in a
position to find probable cause. The evidentiary
value of a purported hit is directly linked to the
number of matching loci and whether or not the
search evidence profile was a mixture. For example, a match at five loci with three alleles missing
may not be particularly strong evidence. Contrast
this with a 13-loci match from a single-source
sample that produced a hit with a convicted
offender sample — in this case, it would be difficult to dispute probable cause.
Remember the context of discovered DNA. A
cold hit does not necessarily mean there is probable cause to believe a crime was committed
and/or the named individual committed a crime.
For example, a Florida man whose DNA profile
was in a databank because of a DNA dragnet
was matched to an earlier unsolved and unrelated rape. The police arrested the man and publicly
announced that they were able to catch the rapist because they had retained DNA samples from

DNA

INITIATIVE

DElAyED PRosECuTions AnD ColD CAsE HiTs

a previous case. The next day, the victim, who
had not been consulted by the police before the
arrest, came forward to proclaim the arrestee’s
innocence. She had consensual sex with the
arrestee shortly before the unknown assailant
raped her.21
If the police make an arrest only on the basis of
a cold hit match, defense counsel should challenge the causal link between a simple match of
DNA and the conclusion that the client committed the crime. Hold the government to meeting
its burden of proof of probable cause that the
client committed the crime, not just that his or
her DNA was found at the scene. For example,
a defendant’s DNA on a cigarette butt found outside a house where a crime occurred does not
— without more evidence — establish probable
cause for arrest.

Fourth Amendment challenges to the client’s
DNA in a databank
Defense counsel should file a Fourth Amendment motion concerning the initial or continued
inclusion of the client’s DNA profile in the databank. The Fourth Amendment can be used to
challenge the legality of law enforcement taking
the client’s DNA, retaining the DNA profile, and
comparing it with an evidence sample profile.22
See Chapter 7, Sections 2 through 8, for more
information.
The strongest challenge to databank inclusion is
if the government has failed to follow the jurisdiction’s controlling statute for DNA. Determine
whether the defendant’s sample was taken and
entered into the databank in compliance with the
statute. For example, the databank statute may
allow for entry of DNA into the databank upon
conviction; however, the client’s DNA may have
been retained and entered into the databank
after he or she was acquitted. Even if the government followed the statute, the defense may be
able to challenge the constitutionality of the client’s inclusion in the databank.23
Even in cases where the client’s sample was
lawfully obtained and entered into the DNA databank, the court should exclude cold hit evidence
if it is unreasonable for the client’s DNA profile
to remain in the databank.24 Courts have nearly

DNA

INITIATIVE

unanimously ruled for the government on these
motions;25 however, as databanks have expanded, some courts have ruled in favor of the defendant’s right not to have his or her DNA taken,
searched or retained in a databank.26 The clear
trend across jurisdictions is to include wider classes of individuals in databanks. Arguably, as databanks include new classes, Fourth Amendment
reasonableness challenges become stronger.
Every state has a statute authorizing the collection of DNA from offenders and inclusion of the
samples in DNA databanks. However, the scope
of individuals subject to entry in the databank varies by state. The earliest statutes included only
people convicted of a small number of violent
felonies and sex offenses. Some jurisdictions
still have these limitations. The trend, however,
has been for states to include increasingly broad
groups of people in the databank, such as all
people convicted of felonies or certain misdemeanors.27 More than half of the states include
juveniles as well as adults.28 Half of the states,
plus the federal government, require the collection of DNA from arrestees.29
Depending on the statute, an acquitted person
may have his or her information removed from
the databank — sometimes presumptively and
sometimes only after petitioning the court. In
jurisdictions where a court petition is required,
counsel should advise clients of their right to
petition to have their information removed from
the database. In many cases, arrestee information may remain in the databank, even after dismissal of the charges or acquittal.
To date, courts have been nearly unanimous in
upholding the validity of DNA databanks; however, the courts have dealt mostly with narrow
statutes affecting people with reduced privacy
interests, such as prisoners. Courts have commonly held that databanks are constitutional as
applied to convicted felons who are incarcerated,
particularly those convicted of violent crimes. In
upholding the statutes, courts have taken into
account that there is no particularized suspicion
in most cases for running an individual’s DNA
profile through a databank, either through a
“totality of the circumstances test” or a “special
needs” test.30

­
129

CHAPTER 9

In Samson v. California, the U.S. Supreme Court
— using a totality of the circumstances test —
upheld a California law permitting suspicionless and
warrantless samples to be taken from parolees.31
The majority in Samson found that the “[s]tate’s
dual interest in integrating probationers back
into the community and combating recidivism”
outweighed the defendant’s privacy interests,
particularly because of the “severely diminished
expectations of privacy” a parolee faced. The
Supreme Court noted that “parolees are more
akin to prisoners than probationers” in their
expectation of privacy.32
For courts, the essence of the Fourth Amendment challenge in a databank case is balancing
the government’s interests against the defendant’s privacy interests.

Expectations of privacy
On the question of privacy rights, there is a continuum from prisoners (who have no reasonable
expectation of privacy)33 to parolees, then probationers. Arrestees — especially ones who are
ultimately acquitted or have the charges against
them dismissed — should have the full privacy
rights afforded by the Fourth Amendment. There
are also people who voluntarily gave their DNA to
law enforcement, and people whose DNA was
surreptitiously collected by law enforcement and
entered into databanks.
Even though the government may have a right to
take DNA samples from incarcerated individuals,
defense counsel may argue that the government
must remove a person’s profile from the databank once he or she is released (or upon completion of any period of parole, supervised release or
probation). Otherwise, the person is still subject
to databank searches, even though he or she no
longer has a reduced expectation of privacy. For
example, when upholding a DNA databank statute, the Ninth Circuit qualified that the case did
not involve “a petitioner who has fully paid his or
her debt to society, who has completely served
his or her term, and who has left the penal system. ... Once those previously on supervised
release have wholly cleared their debt to society,
the question may be raised, ‘Should the CODIS
entry be erased?’”34

130

If the statute allows taking DNA from nonviolent offenders — such as statutes mandating
DNA collection from all convicted felons — then
there is a stronger challenge if the defendant
was entered into the databank for a nonviolent
offense because the prosecution may not be
able to connect the DNA collection with deterrence. The government interest in reducing
recidivism through each convict’s fear of being
caught in future crimes is lessened in the case
of people convicted of crimes where DNA evidence is not relevant. Although some courts
have upheld DNA databanks requiring samples
from broad classes of offenders, two courts have
found statutes that allow broad DNA collection to
be unconstitutional.35

Rights of juvenile and adult arrestees
Defense attorneys should consider challenging
DNA databank statutes as applied to juveniles,
even if they have been upheld as constitutional
for adult offenders. Convicted juveniles may have
increased privacy interests compared with adults
convicted of the same crimes. A “juvenile’s relationship to the state and the state’s public policy
favoring confidentiality of juvenile proceedings
are factors that should be considered in balancing the interests” between a person’s Fourth
Amendment rights and the state’s interests.36
To date, one state court has declared the practice of seizing DNA from all arrestees unconstitutional.37 This issue is likely to receive more
attention. Federal legislation enacted in 2006
allows DNA testing of all persons arrested for
federal criminal felonies,38 and the trend among
the states is toward arrestee databanks.

When DNA of a person who was not
convicted or arrested is entered into a
databank
During the investigation of a crime, law enforcement officers might take DNA samples from discarded objects without the knowledge or
consent of the person whose DNA is being
taken. This information might then be compared
with an evidence profile. Refer to Chapter 7, Section 7, for additional information.

DNA

INITIATIVE

DElAyED PRosECuTions AnD ColD CAsE HiTs

Law enforcement has increasingly used DNA
dragnets to collect genetic information that is
sometimes compared with evidence in the DNA
databanks.39 In a DNA dragnet, law enforcement
officers investigating an offense ask the eligible
population of a community for “voluntary” DNA
samples. After the investigation, police might
then submit the profiles of these innocent people
for entry into DNA databanks. See Chapter 7,
Section 6, for additional information.

Understanding the evidentiary and
statistical significance of a CODIS match
To be meaningful, DNA evidence must be
accompanied by an accurate statistical estimate
of its probative value.40 In a cold hit case, when
the profile generated is from a single source,
the government analyst will generate a random
match probability (RMP) statistic. Although use
of RMP is a well-established way to express a
DNA match’s statistical significance, some scientists are divided on the appropriate methodology
in cold hit cases. Defense counsel must understand competing methodologies.
Prosecuting authorities and crime lab personnel
may prefer to use RMP in cold hit cases, arguing
that the databank search process has no effect
on the RMP.41 However, another view holds that
random match probability is not the appropriate method to determine the chance that the
evidence profile might coincidentally match the
suspect in a databank. This view holds that the
search process must be taken into account in
expressing the statistical significance of a DNA
match that originated as a cold hit.42
Statistically speaking, using this approach, the
more profiles that are searched, the more likely
a coincidental match will be found. To use an
analogy, suppose the perpetrator’s birthday is
known. If a suspect case is developed on the
basis of other evidence, such as eyewitness
identification, and then a DNA sample is taken,
the RMP is an appropriate measure of the
chance of a coincidental match — in this case, 1
in 365. If the suspect’s birthday matches that of
the perpetrator, it is useful additional evidence.
On the other hand, imagine the suspect was
identified by pulling 200 names out of a phonebook and investigating each person’s birthday

DNA

INITIATIVE

(analogous to a form of databank search) — and
one person matched. The RMP is still 1 in 365,
but it cannot be discounted that the police would
expect to find a person with a matching birthday
after searching 200 people.
In 1992, the National Research Council, the principal operating arm of the National Academies
of Science, established the Committee on DNA
Forensic Science (NRC I) to address various
aspects of the science of DNA forensics, including the methodology for computing the statistical
significance of a cold hit.43 NRC I recommended
the confirmatory loci approach, which involves
first finding a match at the minimum number of
loci needed to make a unique match within the
databank (or a higher number if the lab wants to
consistently search a set number of loci). Once a
match is identified, the lab would then compare
the remaining loci from the evidence sample
with the same loci from the sample identified by
the databank search.
For example, if the laboratory can test a total of
13 loci, and it used six loci to make the search
that resulted in the cold hit, it would then compare the remaining seven loci. If the two samples
match at the additional “confirmatory” loci, then
the lab would calculate an RMP based solely on
the confirmatory loci. The RMP associated with
the confirmatory loci would accurately express
the statistical significance of the match between
the suspect sample and the evidentiary sample
at those loci. In other words, the second confirmatory step of this approach removes any effect
the databank search may have on the calculation
of the likelihood of a coincidental match.
The NRC I approach will often present the highest statistical likelihood — and thus the most
favorable statistic for the defendant — because
the loci used in the search that resulted in the
cold hit are not included in the statistical figure presented to the jury. This approach was
recommended at a time when fewer loci were
available for testing, and some criticized it for
wasting information. However, 15 autosomal
STR loci are currently able to be routinely typed
in forensic labs using multiplex DNA typing kits
that have been validated for forensic use and are
on the market.44 In addition, 26 other autosomal
STR locations have been identified as suitable
for forensic application (though not yet validated

­
131

CHAPTER 9

for use in forensic casework),45 and the National
Institute of Standards and Technology (NIST) is
actively developing these and other genetic locations that have been identified “so as to permit
use of the product rule when combining data
between CODIS STR and [the new] loci.”46
In 1996, the National Research Council on DNA
Forensic Science convened another expert committee (NRC II), which, among other things,
proposed an alternate methodology for computing a cold hit’s statistical significance. As in the
preceding committee, NRC II avowed that the
statistic “should take into account the search
process.”47
NRC II did not recommend use of RMP in a cold
hit case. As its report points out, if you toss 20
coins, the chance of getting all heads is about
1 in 1 million (you might think the coins were
weighted if you got all heads). However, if you
repeat the experiment 1 million times, the fact
that one of the experiments yields all heads
would not seem strange. Although it reiterated
that the NRC I method was “a sound procedure,” NRC II was concerned that the NRC I
method did not use all loci in deriving the
statistic.48
Instead of RMP, NRC II recommended a methodology called the databank match probability
(DMP); it is also known as Np, from the mathematical formula that is used. Under the method’s
simplified form, one would multiply the probability representing the profile’s frequency (p,
equivalent to its RMP) by the number of items
searched (N, the size of the databank) to derive
the match’s statistical significance.49 Applying
the rough formula to the birthday example yields:
1/365 × 200 = 200/365, or 1 in 1.8 — about a 55percent chance of getting a match, having made
200 comparisons.
Accordingly, the DMP is calculated by simply
multiplying the RMP by the size of the databank.
For example, if you had an RMP of 1 in 10 billion and a databank size of 1 million individuals,
the DMP statistic would result in a 1-in-10,000
chance of finding that profile in the database:
(1 ÷ 10 billion) × 1 million. NRC II’s DMP method
is usually more discriminating than the NRC I
confirmatory loci approach.

132

In 2000, DAB, an FBI commission responsible
for promulgating standard practices relating to
the use of DNA evidence at that time, released a
report on cold hit statistics and proposed its own
solution. DAB approved of NRC II’s recommendation of relying on the DMP “for the evaluation
of DNA evidence from a databank search” but
also noted that the RMP is “of particular interest” in a cold hit case.50 The DAB recommended
that both RMP and DMP be reported to the jury.
Using the birthday example, this would entail
reporting both “1 in 365” and “1 in 1.8,” explaining that the 1-in-365 statistic represents the
probability that a random person would match
the evidence profile, and the 1-in-1.8 statistic represents the probability that someone in the databank would match by coincidence. Per this DAB
approach, if both the RMP and DMP are reported
to the jury, the jury will learn that the defendant
was previously in the database.
A fourth approach to deriving a cold hit’s statistical significance was developed by genetic
statisticians, Drs. David Balding and Peter Donnelly, of Imperial College of London and Oxford
University, respectively.51 These scientists use a
Bayesian approach and make what proponents
consider to be a critical distinction at the outset
— the difference between the forward-looking
probability of finding a coincidental match when
searching a databank of a given size and the
probability that a particular match is coincidental,
having already conducted the search.52 In general, U.S. courts have not accepted Bayesian statistics, and the same has been true for the Balding
and Donnelly approach. Still, it is notable —
especially for those in a Frye jurisdiction — that
yet another competing statistical methodology
exists for calculating the significance of a cold
hit.
Despite the different approaches outlined above,
the prosecution frequently includes the RMP
statistic. The government relies on several
arguments:
■■

Random match probability and other methods
answer different questions.

■■

RMP is always relevant, even if another
statistic, such as DMP, is also relevant.

■■

Retesting the client’s sample after the initial
cold hit allows the use of RMP.53

DNA

INITIATIVE

DElAyED PRosECuTions AnD ColD CAsE HiTs

The counter to these prosecution arguments
is that, first, the RMP does answer a different
question: It determines the odds that an individual randomly selected from the population would
match the evidence sample. The question is not
about the odds of finding a coincidental match
by conducting a cold hit. In every case, the central question is whether the statistic properly
explains the significance of the match — that is,
whether it demonstrates the likelihood of a coincidental match in a particular case.

Section 6: Arizona Databank
Matches and Use of Random Match
Probability in Discovery Litigation

■■

The estimated allele frequencies are accurate.

The government’s related argument — that the
RMP is relevant because it gives information
about the rarity of the profile — has gained traction with some courts.54 However, even though
some contend that the expected frequency or
rarity of a particular profile is a relevant statistic,
that information is not directly dispositive of the
central question before the jury, which is the likelihood of mistaken identification or false inclusion
by coincidence.55

■■

The autosomal STR loci used to develop the
DNA profile are independent of one another.
Forensic scientists multiply the allelic frequency estimates of each forensic locus by the others’ estimates by using the product rule.

■■

The population from which the RMP is derived
has been demonstrated to be in HardyWeinberg equilibrium.57

Finally, retesting DNA evidence at the exact
same genetic locations is a useful quality check
to ensure that the profile in the databank is, in
fact, the defendant’s, but it does not alter the
coincidence assessment.56 If a databank search
results in a coincidental match, retesting the
same genetic markers simply repeats the coincidence. The factor that brings a particular case
into the class of a “cold hit” for statistical purposes is the manner in which the suspect was
first identified. Whether the prosecution provides
the jury with the RMP or some other derivative
statistic that accounts for the search process,
defense counsel should explore the fundamental
assumptions that underpin the RMP in every cold
hit case.
All this being said, it is important to be aware
that as of 2011, the relevant scientific community has generally accepted the use of the RMP
calculations for cases involving a databank hit.
Furthermore, counsel must keep in mind that a
statistical approach that includes databank size
in the calculation raises a serious concern that
the jury will learn of their client’s prior arrests or
convictions.
Cautionary Note: Counsel is strongly encouraged
to consult with a statistician in a cold hit case.

DNA

INITIATIVE

As previously discussed, the RMP is determined
by following a population genetics model that
rests upon several assumptions. The model
assumes the following:

This theoretical model governs the admission of
DNA match evidence in courtrooms throughout
the United States. However, a recent study,
showing a number of matches at nine or more
loci in the Arizona databank, has raised preliminary questions about the meaning of RMP, particularly with respect to cold hit cases. Defense
counsel should consider filing a motion to compel the state’s databank authority or the FBI to
run a search similar to the one discussed later on
the state databank (or NDIS, in the case of the
FBI).
In 2001, the Arizona Department of Public Safety
Crime Laboratory (Arizona DPS) searched its
convicted offender databank and observed a
nine-STR-loci match between two apparently
unrelated individuals (one a Caucasian, the other
an African-American).58 This was the first report
of a coincidental match of more than six loci in
the United States, so the forensic science community treated it as unusual and noteworthy,
meriting heightened attention.59
As recently as spring 2005, well-known geneticists who frequently testify for the prosecution
treated the 2001 Arizona DPS report as an outlier. They testified, under oath, that matches at
9, 10 or more loci are extremely rare. Scientists
associated with crime laboratories testified that
a 9- or 10-loci match in two individuals is exceedingly unusual and that the only known 10-loci
match involved an incestuous relationship.60

­
133

CHAPTER 9

In fall 2005, Arizona DPS compared the DNA profiles of each of the 65,493 people in its convicted
offender databank with each other. Arizona DPS
reported some remarkable findings: Its databank
contained 122 pairs of people matching at nine
of the 13 loci; 20 pairs that matched at 10 loci;
one pair that matched at 11 loci; and one pair
that matched at 12 loci. The last two matches
were confirmed to be siblings.61 If the RMP was
calculated for each pair, the statistics would be
exceedingly rare.62
Conversely, such matches are expected.63
Recent studies illustrate the possibility that siblings may have nearly perfect matches across
the 13 STR loci, an issue of particular importance
when suspects are charged on the basis of a
cold hit.64
When comparing each sample in a databank, the
number of actual comparisons climbs to astronomical numbers. The Arizona databank examples may be perfectly explained by the presence
of related people in the databank (studies of this
began in 2008).65 However, the Arizona matches
may indicate some additional problems with the
meaning of random match probability, as there is
some evidence that the number of matches cannot simply be accounted for by the presence of
close relatives.66 In addition, the Arizona matches
may provide jurors with a different perspective
regarding a match’s significance.
Defense counsel should try to learn the number
of coincidental matches in the searched databank. This will support the defense’s case in at
least three ways:
1. It provides additional support for the argument that the RMP is not relevant in a databank case. The coincidental match illustrates
that the RMP may overestimate the odds of a
coincidental match when many comparisons,
instead of just one, are made.
2. Observing a high number — any number
smaller than the RMP, what is expected,
according to government claims — helps minimize the significance of the DNA evidence.
3. Using empirical data available through a
CODIS search, counsel may be able to give

134

the jury a number that more accurately
reflects the chance that the match is coincidental.
Presented simply and straightforwardly, these
matches can assist the defense in providing a
significant, relevant statistic as to the probability
of a coincidental match.
Empirical inquiry into the databanks can also
help support the proposition that DNA profiling
errors occur. For example, just as there should
be fewer 13-loci matches than 12-loci matches
across the 13 loci, there should be fewer 25out-of-26 allele matches than 24-out-of-26 allele
matches. If the converse turns out to be true,
that might suggest the presence of single-allele
typing errors in the entry of databank profiles, or
transcription errors.
Some judges have ordered searches of their
state convicted offender databanks to determine
whether there were pair-wise matches at nine
or more loci.67 The Illinois databank contained
220,000 convicted offender samples; 903 pairs
matched at nine or more loci. The Maryland
convicted offender databank contained fewer
than 30,000 profiles; 32 pairs matched at nine
or more loci, and three pairs matched at all 13
loci. Although a news article reported that, as of
July 2008, Maryland officials had not researched
whether the matches were duplicates, identical twins, brothers or unrelated people,68 the
Maryland State CODIS Administrator had already
confirmed, by entering the profile of the second
twin — in each of these three pairs of samples
from identical twins — that the samples were
truly from identical twins. Fingerprint comparisons were used to confirm that each twin was
a different individual and that the samples were
not duplicate submissions from the same person; the profile from each twin was left in the
databank because the offender samples were
collected from different individuals compelled to
provide DNA under Maryland state law).
In court proceedings, the FBI has routinely
refused to examine the national CODIS databank
for pair-wise comparisons, as was done in the
Maryland, Arizona and Illinois SDIS databanks.

DNA

INITIATIVE

DElAyED PRosECuTions AnD ColD CAsE HiTs

Requesting access to DNA databanks
or asking the government to run a
comparison match
The prosecution may oppose a defense counsel
request to run a comparison search based on an
argument that would impose a time burden.
The prosecution has also argued that labs are not
authorized to run this kind of search on the basis
of one interpretation of the authorizing statute
(42 U.S.C. §14132). States have argued that,
under the statute, only databank records relating to DNA analysis for that particular case may
be provided to a criminal defendant. The statute
actually provides:
(3) ... pursuant to rules that allow disclosure
of stored DNA samples and DNA analyses
only (B) in judicial proceedings, if otherwise
admissible pursuant to applicable statutes
or rules; (C) for criminal defense purposes,
to a defendant, who shall have access to
samples and analyses performed in connection with the case in which such defendant
is charged; or (D) if personally identifiable
information is removed, for a population statistics database, for identification research
and protocol development purposes, or for
quality control purposes.
The government crime lab may object to the
release of personal identification information.
In response, the defense can argue that NDIS
does not contain personal information such as
names. It can also be argued that if the government were to turn over the data to the defense’s
expert, he or she could remove any identifying
information. Even if a personal identifier number
were included, the defense would have no way
of connecting that number to an actual person
without access to the FBI’s operational identifiers. Most important, the defense does not need
identifying information; it needs only a report of
the number of matches at nine or more loci.
The prosecution or crime lab may also argue
against disclosure because the lab’s Memorandum of Understanding with the FBI, which
allows its use of CODIS, states that (1) the lab
must take reasonable precautions to prevent
unauthorized persons from accessing the CODIS

DNA

INITIATIVE

software, and (2) labs will abide by the procedures for record access in the Privacy Act Notice
and the NDIS responsibilities and procedures
manuals. The Privacy Act authorizes the same
disclosures as the DNA Act (discussed earlier),
including release to researchers and by court
order.69 The purpose of such a search is to present a defense and obtain exculpatory information
from the government.

Scope of requests and eliminating
duplicates
Prosecution and crime labs have also argued
that the scope of the request — to find matches
of nine or more loci — is excessive. However,
even nine loci can generate miniscule RMPs. The
defense can also give the court the option of limiting the search to matches of 10 or more loci, if
necessary.
The prosecution has previously argued that it
needs significant time to sort out duplicates
and relatives among the matching profiles. The
prosecution has expressed concern that the
results of the match will be misleading because
the databanks contain some duplicates and do
not consist of random samples.70 However,
duplicates are easily identified. First, they would
definitely match at all 13 loci. The next step
would be to pull the case files to determine the
source(s) and whether they are, in fact, duplicates or a true coincidental match. As for the
identification of relatives in the databank, it is
speculative to say how long this would take. If
the government produces evidence showing a
high number of matches, then the government
can, if it wants, seek to determine if any of the
matches are duplicates or relatives.
Finally, the prosecution might argue that such
a search is irrelevant. However, a cold hit DNA
case hinges on the significance of the DNA
match. The match data provide useful fodder for
cross-examining the government’s witnesses
and could create reasonable doubt about the
government’s statistics. The Arizona, Maryland
and Illinois matches are prima facie evidence to
believe that there are coincidental matches in the
state’s databank. Performing such a search can

­
135

CHAPTER 9

be critical to representing the defense’s client
effectively.

Section 7: Identifying the Theory
of Defense: Defenses Specifically
Based on a Cold Hit
In addition to normal defenses, counsel should
consider the following three defense theories
with an eye to the differences in a cold hit case:
■■

The RMP statistic does not address the correct question because the defendant was
identified through a cold hit.

■■

The cold hit was the product of contamination
or innocent presence.

■■

The government did not do enough testing
and databank searching to prove that the
defendant was the perpetrator.

Section 8: Statistics
Defense counsel should consider making a
motion to prevent the prosecution from introducing the RMP as evidence in a cold hit case.
Depending on the test used in the jurisdiction,
counsel can argue that the prosecution’s RMP
statistic is not generally accepted or not reliable
in a cold hit case. Appellate courts in both Frye
jurisdictions that have considered this argument
have rejected it and upheld admission of the
RMP in cold hit cases.71 There have been no
Daubert-based decisions.
If the RMP is admitted, the defense can seek to
discredit the statistic through the methods available in all DNA cases: The number is based on
datasets of 150–200 people. The independence
of genetic locations is an assumption. The databases relied upon are not truly in Hardy-Weinberg
equilibrium, and the RMP does not account for
relatives. RMP’s applicability in a cold hit case
can also be challenged. Use the information (discussed earlier) on how RMP answers a different
question than DMP. Also, the defense can
introduce its own statistics. Apply the NRC I
(confirmatory loci) or NRC II (DMP/Np) methodologies to the client’s databank match and argue
for the admission of one or both of these statistics. The NRC II method is admitted as evidence

136

more easily, as more scientists are willing to
vouch for its reliability, but NRC I may produce a
more exculpatory number. Furthermore, defense
counsel can cross-examine the state’s expert by
citing scientific journal articles and NRC publications to demonstrate the relevance — or lack
thereof — of the RMP in a cold hit case.
When cross-examining witnesses who report the
random match probability, consider challenging
their qualifications — they are often forensic scientists and not population geneticists or statisticians. Scientists will agree there are alternative
methods for calculating the relevant statistic.
For example, the DAB, an FBI-convened group,
approved use of the NRC II method. Ask the witness about ascertainment bias and use articles,
treatises, and the NRC I and II reports. Point out
that the NRC II report states that the NRC I confirmatory loci approach is acceptable. Establish
that the lab could have used the NRC I approach
but chose not to (it could have run a databank
search, one location at a time, until there was
only one match in the databank). Use the Arizona
match results to show that, despite a small RMP,
matches at many loci are expected. If defense
counsel is able to get Arizona-style databank
search match information from the government
for your state, use it. If not, consider establishing
the defense’s request, in writing, and the government’s refusal to provide the data. Without
such a search, the government cannot say with
certainty that there are no coincidental 10-, 11-,
12- or even 13-loci matches in the databank.

Section 9: Contamination
There have been several cold hit cases worldwide involving contamination. Use these examples to see if there is a plausible contamination
theory in the defense’s case.
■■

In 1998, an Australian toddler was found dead
after having been preserved in icy water for
months.72 In 2003, there was a DNA databank
hit based on DNA from the victim’s bib and
pants. The “match” was a young woman from
the opposite coast with no apparent connection to the victim. It turns out that the matching “perpetrator” was a rape victim, and the
same lab that handled the DNA from the murder victim’s clothing had processed her DNA.

DNA

INITIATIVE

DElAyED PRosECuTions AnD ColD CAsE HiTs

The samples from the rape victim were tested
in the lab during February 2–5, 1998. The bib
and pants were examined on February 2 or 3;
the DNA was extracted on February 4, 1998.
The rape victim was not charged in the toddler’s death.73
■■

■■

■■

There have also been false cold hits due to
laboratory contamination in the United States.
A Washington state police lab contaminated
samples in a rape case. The error was caught
because the suspect had been a young child
when the rape occurred. The lab admitted
that “the felon’s sample was being used as a
training sample by another analyst” when the
rape case was being analyzed.74 In a separate
case, a California law enforcement crime lab
accidentally cross-contaminated samples from
two different rape cases being processed at
the same time.75
Questions remain about the 1969 murder
of a Michigan woman. In December 2003,
police received a DNA match based on a cold
hit of an evidence sample, but the matched
person was only 4 years old at the time of
the woman’s death. A sample from another
convicted offender was tested at the same
lab and matched another item of evidence in
the case. Police have failed to come up with
an explanation for the first match; there was
no obvious evidence of laboratory contamination.76 The second match was eventually tried
and convicted on the basis of his DNA match.
The case is currently under appeal.
In an Australian rape case, after numerous
inquiries by defense counsel, the crime laboratory withdrew an alleged cold hit match and
admitted “there may have been a contamination event or a laboratory error during the DNA
extraction process.”77

When faced with a cold hit case, investigate how
the defendant’s profile originally got into the
databank. As mentioned previously, some local
and state databanks upload suspect profiles that
the FBI does not allow in NDIS. For example,
the crime lab in Erie County, N.Y., collected and
entered DNA profiles from crime victims into its
local databank.78 If the defendant’s profile that
resulted in the hit was uploaded into a local database but would not have met the FBI’s standards
for uploading into NDIS, the defense should
pursue this line of questioning during crossexamination.

DNA

INITIATIVE

Counsel also must check whether the same facility processed both the evidence sample and the
defendant’s offender DNA sample. If so, verify
the facilities layout, staffing procedures, workflow and timing to see if there could have been
contamination. If the lab processed the defendant’s DNA sample before or at the same time
as the evidence sample, or if the two samples
could have come into contact with each other
(directly or through secondary transfer, such as
an analyst who is assigned to both the databank
and the casework analysis units), then consider
contamination as a possibility.

Section 10: When the Government
Cannot Produce Certain Evidence
In a cold hit case, the prosecution will often lack
more traditional evidence, such as eyewitness
identifications or fingerprints. Along with an
attack on the reliability of the proposed cold hit
evidence (whether by claiming contamination or
a misstatement of the match’s statistical significance), defense counsel can highlight how much
evidence the prosecution cannot produce for the
jury.
Counsel should challenge the claim that a cold
hit match between the defendant’s DNA and an
evidence sample means that the defendant committed a crime — particularly when there is no
corroborating evidence. In a St. Louis case, prosecutors dismissed two rape-murder cases where
the DNA evidence against the suspect showed
that the suspect had sex with the women, both
of whom were murdered. After a jailhouse informant died, no other evidence linked the suspect
to the crime. In fact, one of the victim’s sisters
was adamant that the suspect was not the man
she saw choking her sister the night before she
was found dead.79

Section 11: Cases in Which No DNA
Evidence Was Tested
When can the defense request initial DNA
testing?
Rules differ from state to state about a defendant’s right to test evidence. Defense counsel’s

­
137

CHAPTER 9

first step should be to determine the jurisdiction’s rules and limitations governing defense
testing.
There may be a case in which DNA testing
was not done and the defense thinks it should
be. An example of this might be when a victim
claims she had never met the defendant before
the alleged rape, but the defendant asserts that
not only did he know her but also they also had
drinks and cigarettes in his apartment the night
before. Testing the cigarettes for DNA profiles
might be the prudent thing to do.
The lawyer should never be the one to collect
evidence; either an investigator knowledgeable
in evidence collection or a law enforcement officer should collect the evidence. The decision of
whether to involve the police will hinge on several factors: First, is the evidence in a place where
an investigator can access it? If not, the choice is
easy. However, if the police and an investigator
have equal access, careful consideration must
be given to who is going to collect the evidence.
Counsel cannot be certain the client is telling the
truth; to be found to be lying about such a thing
could be devastating to the defense. As such, it
may be best to have an investigator collect the
evidence and send it to a private lab for testing.
Alternatively, the evidence the defense wishes
to test may be in state custody. In this case,
the first question is, “Should the defense ask
the jurisdictional lab to perform testing or send
the item to a private lab?” Counsel may wish to
contact the lab or the prosecution and ask about
the lab’s policy — does the lab do testing at the
request of the defense?
If items are to be sent out for testing, the
defense should consider what items it will
request from the lab or investigating agency.
Asking for a single item of evidence will, of
course, let the investigator know what the
defense is testing. It may be wise to ask for
a number of items — or all of the items — so
that the testing of the item of interest is done
without highlighting the goal. Additionally, the
defense should consider to whom it requests
the items be released. If the agency that has
custody of the evidence sends the items directly
to the private lab, that agency naturally knows
who is doing the testing. In some jurisdictions,
this could result in the prosecution calling the

138

lab scientist or investigator to testify on behalf of
the state. Counsel should consider having their
investigator pick up the items from the custodial
agency and then sending them out for testing. It
is a good idea to speak with the prosecutor about
chain-of-custody issues before the items leave
the agency that has custody of the evidence.
It is important to be aware that a private lab (a
non-CODIS lab) will not have the ability to upload
and/or search any profiles that are generated
using CODIS if this is of interest once the results
of testing are reviewed.

When and what evidence can be retested?
There may be cases in which DNA testing was
already performed by the state but the defense
chooses to have items retested. Counsel should
know whether the jurisdiction allows confidential
retesting. If the retest shows the same result as
the state lab, the defense may be bolstering the
state’s case. Will the jury be made aware that
retesting was a possibility? In many cases, in
order to render effective assistance of counsel,
an expert must be consulted.
Alternatively, the defense may want to have
additional testing performed on items of evidence. There may be cases where it would be
helpful to attempt to identify other contributors.
Consider a situation in which the state performs
STR testing on items of evidence, obtains partial profile information, and does not exclude
the defendant — but it also observes or reports
additional DNA types that are perhaps below
the lab’s sensitivity threshold. This information
may not be in the analytical report, but it should
be found as raw data in the case file, which
can be obtained through a discovery request.
Testing the evidence with different DNA markers (such as Y-STRs, mtDNA or miniSTRs) may
help identify the additional contributors or show
that the defendant is actually excluded. A qualified expert should help counsel decide whether
to have additional testing conducted and new
results interpreted. Be aware that a private lab (a
non-CODIS lab) will not have the ability to upload
or search any profiles that are generated using
CODIS, should a foreign or nonattributed DNA
profile be generated. See Chapter 5, Section 14,
for a discussion regarding this issue.

DNA

INITIATIVE

DElAyED PRosECuTions AnD ColD CAsE HiTs

What if there is no DNA evidence?
The lack of DNA analysis may be important to
the defense’s case. Counsel should determine
whether evidence not collected or tested could
have provided probative information, such as a
sexual assault case in which the police did not
collect, or collected but did not test, the victim’s
clothing. Jurors have come to expect DNA evidence to be presented in certain types of cases.
It may also be possible that DNA was unavailable
because the crime was not reported immediately. One argument that could be made is that
the victim knew about DNA testing and delayed
reporting because DNA evidence would not
support his or her claim. In a case where police
officers fail to collect evidence, it is important to
establish that the particular officer who failed to
collect the items was knowledgeable in evidence
collection procedures. For example, a used glass
at the crime scene could have identified someone who handled or drank from the glass. Or, if
a cigarette butt at the crime scene was not collected, does the defendant smoke cigarettes?

Endnotes
1. United States v. Marion, 404 U.S. 307, 322
(U.S. 1971).
2. Stogner v. California, 123 S. Ct. 2446, 2452
(U.S. 2003).
3. Stogner v. California, 123 S. Ct. 2446, 2461
(U.S. 2003) (“a law enacted after expiration of a
previously applicable limitations period violates
the Ex Post Facto Clause when it is applied to
revive a previously time-barred prosecution”).
4. State v. Garcia, 169 P.3d 1069 (Kan. 2007).
5. Stogner v. California, 123 S. Ct. 2446, 2454
(U.S. 2003).
6. See National Conference of State Legislatures,
Statutes of Limitations for Sexual Assaults (April
2007), www.ncsl.org/programs/cj/IncludingDNA.
htm.
7. See, e.g., Commonwealth v. Laventure, 894
A.2d 109, 118 (Pa. 2006) (finding inadequate a
warrant describing the perpetrator as “John Doe

DNA

INITIATIVE

Steve, having an unknown address, and who
was a white male, in his thirties” but citing to
cases where a partial description coupled with
a location were deemed sufficient). Professor
Wayne R. LaFave has taken the position that a
John Doe arrest warrant satisfies the particularity
requirement if it describes the person’s “occupation, his personal appearance, peculiarities, place
or residence or other means of identification,”
LaFave, X., 3 W ayne R. Search and Seizure §§
5.1(g) (3d ed. 1996 & Supp. 2003) (footnote citations omitted).
8. People v. Robinson, 156 Cal. App. 4th 508,
520 (Cal. Ct. App. 2007); People v. Robinson, 156
Cal. App. 4th 508: Subsequent appellate history
contains negative analysis. State v. Danley, 853
N.E.2d 1224, 1227 (Ohio 2006); State v. Dabney,
663 N.W.2d 366 (Wis. App. 2003).
9. State v. Dabney, 663 N.W.2d 366, 374 (Wis.
Ct. App. 2003) (“a defendant is not entitled to
specific notice that the state is issuing a complaint and seeking an arrest warrant”).
10. United States v. Gouveia, 104 S. Ct. 2292,
2300 (1984).
11. See, e.g., Commonwealth v. Scher, 803 A.2d
1204, 1221-1222 (Pa. 2002) (allowing the claim
where “the evidence shows that the delay was
the product of intentional, bad faith, or reckless
conduct by the prosecution”).
12. Goldfarb, “When Judges Abandon Analogy:
The Problem of Delay in Commencing Criminal Prosecutions,” 31 W m . & m aR y L. R e v . 607
(Spring 1990).
13. See www.fbi.gov/hq/lab/pdf/codisbrochure.pdf.
14. FBI statistics on NDIS are available at http://
www.fbi.gov/about-us/lab/codis/ndis-statistics.
15. See, e.g., 42 U.S.C. § 14132.
16. See 42 U.S.C. § 14135(b), National DNA
Index System DNA Acceptance Standards.
17. Updated information on the coverage of
each state’s DNA statute can be found at
www.dnaresource.com.

­
139

CHAPTER 9

18. See generally, Whiteley v. Warden, 401 U.S.
560 (1971) (judicial officer issuing warrant must
be “supplied with sufficient information to support an independent judgment that probable
cause exists”). Whiteley v. Warden, 401 U.S.
560: Overruled in part as stated in: Thompson v.
Wagner, 2008 U.S. Dist. LEXIS 75066 (W.D. Pa.
Sept. 29, 2008).
19. Sweeney, A., and F. Main, “Botched DNA
Report Falsely Implicates Woman: Case Compels
State to Change How It Reports Lab Findings,”
C hiCago S un -T im e S (Nov. 8, 2004), at 18.
20. “‘It could call into question the integrity of
DNA evidence,’ one source said. ‘Do we have
probable cause to take someone into custody
for questioning based on an ‘investigative lead’
from a partial DNA match? It raises serious legal
issues.’” (Id.)
21. See P.J. Neufeld, Co-Director of the Innocence Project, Member of N.Y. State’s Forensic
Science Review Board, Testimony at the Subcommittee on Crime, Terrorism, and Homeland
Security (July 17, 2003); see also EPIC 5th Circuit
Amicus Brief on DNA Dragnets.
22. Courts agree that the taking and analysis of a
person’s DNA is subject to Fourth Amendment
protections. Nicholas v. Goord, 430 F.3d 652,
658 (2d Cir. 2005); Nicholas v. Goord, 430 F.3d
652: United States v. Sczubelek, 402 F.3d 175,
182 (3rd Cir. 2005); Jones v. Murray, 962 F.2d
302, 306 (4th Cir. 1992); Groceman v. United
States Dep’t of Justice, 354 F.3d 411, 413 (5th
Cir. 2004) (per curiam); Green v. Berge, 354 F.3d
675, 676-77 (7th Cir. 2004); United States v. Kincade, 379 F.3d 813, 821 (9th Cir. 2004); United
States v. Kimler, 335 F.3d 1132, 1146 (10th Cir.
2003); Padgett v. Donald, 401 F.3d 1273, 1277
(11th Cir. 2005); Johnson v. Quander, 440 F.3d
489, 493 (D.C. Cir. 2006).
23. Remember to challenge the client’s inclusion
in the databank on the basis of the state constitution in addition to the federal Constitution.
24. The search of a DNA profile and its continued retention in a databank fall under the Fourth
Amendment, just like the initial extraction of a
person’s DNA, even if there was nothing wrongful in the initial extraction of a person’s DNA. See

140

United States v. Stewart, 468 F. Supp. 2d 261,
264-65 (D. Mass. 2007) (“the first expectation of
privacy concerns the physical penetration of the
person to extract the blood. The second expectation is implicated when the blood is tested and
the information contained in DNA is revealed”)
(citing Skinner v. Railway Labor Executives’
Ass’n, 489 U.S. 602, 616 (though urine samples
do not require surgical intrusion of the body,
“chemical analysis of urine, like that of blood,
can reveal a host of private medical facts about
an employee, including whether he or she is
epileptic, pregnant, or diabetic”)); United States
v. Stewart, 468 F. Supp. 2d 261. See also, Ferguson v. City of Charleston, 532 U.S. 67, 76 (2001)
(test of a urine sample implicates the Fourth
Amendment).
25. See, e.g., United States v. Amerson, 483
F.3d 73, 79 (2d Cir. 2007); United States v.
Sczubelek, 402 F.3d 175, 184 (3d Cir. 2005);
Jones v. Murray, 962 F.2d 302 (4th Cir. 1992);
Groceman v. U.S. Department of Justice, 354
F.3d 411 (5th Cir. 2004); Green v. Berge, 354
F.3d 675 (7th Cir. 2004); United States v. Kraklio, 451 F.3d 922, 924-25 (8th Cir. 2006); United
States v. Kriesel, 508 F.3d 941 (9th Cir. 2007);
Padgett v. Donald, 401 F.3d 1273, 1280 (11th Cir.
2005); Johnson v. Quander, 440 F.3d 489, 496
(D.C. Cir. 2006).
26. See Stewart, 468 F. Supp. 2d at 261; In Re:
C.T.L., 722 N.W.2d 484 (Minn. Ct. App. 2006);
Stewart, 468 F. Supp. 2d at 261: Reversed by:
United States v. Stewart, 532 F.3d 32, 2008 U.S.
App. LEXIS 14469 (1st Cir. Mass. 2008). Vermont v. Watkins (Vt. Dist. Ct. App. 24. 2006) (No.
6805-2-04).
27. See generally, www.dnaresource.com/
documents/statequalifyingoffenses2011.pdf (as
of the end of 2007, 34 states included some misdemeanors as qualifying offenses, and 45 states
include all convicted felons).
28. Id.
29. Id.
30. Unlike the totality of the circumstances test,
if the special needs test is applied, the government must prove that the search is justified by
a special need beyond the ordinary need for law
enforcement. Griffin v. Wisconsin, 483 U.S. 868,

DNA

INITIATIVE

DElAyED PRosECuTions AnD ColD CAsE HiTs

873 (1987). Thus, it may be beneficial to argue
that the special needs test applies in the case.
See United States v. Amerson, 483 F.3d 73, 79
n. 6 (2d Cir. 2007) (special needs test, as applied
in the 2nd Circuit, is “more stringent” than the
general balancing test because it requires a
threshold step before engaging in a balancing
test, unlike the “totality of the circumstances”
test) (citing Nicholas v. Goord, 430 F.3d 652,
664 n. 22 (2d Cir. 2005)); Nicholas v. Goord, 430
F.3d 652. See also, United States v. Kincaide,
379 F.3d 813 (9th Cir. 2004) (in 6-5 decision, five
of the judges in the majority applied “totality of
the circumstances” and one applied “special
needs,” whereas the five dissenting judges
applied “special needs”). However, see United
States v. Sczubelek, 402 F.3d 175 (3rd Cir. 2005)
(stating, without explanation, that the “totality of
the circumstances” test is “more rigorous” than
the “special needs test”).
31. 547 U.S. 843 (2006). Although some federal
courts (2nd and 7th Circuits) still use a special
needs test for some categories, the U.S.
Supreme Court’s decision in Samson, plus the
weight of the majority of courts addressing the
issue, means that counsel probably will be working with the totality of the circumstances balancing test when dealing with persons with reduced
expectations of privacy. However, the Second
Circuit argues that “nothing in Samson suggests
that a general balancing test should replace special needs as the primary mode of analysis of
suspicionless searches outside the context of
the highly diminished expectation of privacy presented in Samson.” United States v. Amerson,
483 F.3d 73, 79 (2d Cir. 2007) (discussing that
probationers (at issue in Amerson) have a greater
expectation of privacy than parolees (at issue in
Samson)).
32. Id. at 2197-2200 & n. 2.
33. Hudson v. Palmer, 468 U.S. 517, 530 (1984).
34. United States v. Kriesel, 508 F.3d 941, 949
(9th Cir. 2007) (quoting United States v. Kincade,
379 F.3d 813, 841 (Gould, J., concurring)); see
also, Green v. Berge, 354 F.3d 675, 679-81 (7th
Cir. 2004) (Easterbrook, J., concurring) (noting
that “[f]elons whose terms have expired” form a
different category of individuals than supervised
releasees for the purposes of a Fourth Amendment inquiry).

DNA

INITIATIVE

35. See United States v. Stewart, 468 F. Supp.
2d 261 (D. Mass. 2007) (finding unconstitutional
the DNA Analysis Backlog Elimination Act of
2000 as applied to a probationer convicted of
Social Security fraud); United States v. Stewart,
468 F. Supp. 2d 261: Vermont v. Watkins, (Vt.
Dist. Ct. App. 24. 2006) (No. 6805-2-04) (invalidating, on state constitutional grounds, the “suspicionless collection and banking” of DNA samples
from all convicted nonviolent felons); however,
see, e.g., Green v. Berge, 354 F.3d 675 (7th Cir.
2004) (upholding Wisc. Stat. Ann. § 165.77 (West
1999)); Jones v. Murray, 962 F.2d 302 (4th Cir.
1992) (upholding Va. Code Ann. § 19.2-310.2
(1990)); Va. Code Ann. § 19.2-310.2. Doles v.
State, 994 P.2d 315 (Wyo. 1999) (upholding Wyo.
Stat. Ann. § 7-19-403 (1997)).
36. In re Calvin S., 150 Cal. App. 4th 443 (Cal.
App. 2007) (recognizing juvenile’s stronger privacy rights but still finding balance of interests
to favor requiring entry of juvenile DNA into
databank).
37. In re C.T.L., 722 N.W.2d 484 (Minn. Ct. App.
2006) (“Because Minn. Stat. § 299C.105, subd.
1(a)(1) and (3) (Supp. 2005), direct law-enforcement personnel to conduct searches without first
obtaining a search warrant based on a neutral
and detached magistrate’s determination that
there is a fair probability that the search will
produce contraband or evidence of a crime, and
because the privacy interest of a person who has
been charged with a criminal offense, but who
has not been convicted, is not outweighed by the
state’s interest in taking a biological specimen
from the person for the purpose of DNA analysis,
the portions of Minn. Stat. § 299C.105, subd. 1(a)
(1) and (3), that direct law-enforcement personnel
to take a biological specimen from a person who
has been charged but not convicted violate the
Fourth Amendment to the United States Constitution and Article I, Section 10, of the Minnesota
Constitution.”), Minn. Stat. § 299C.105.
38. See 42 U.S.C. § 14135a(a)(1)(A) (2006).
39. See Walker, S., “Police DNA ‘Sweeps’
Extremely Unproductive: A National Survey of
Police DNA ‘Sweeps,’” P oLiCe P R ofe S S ionaLiS m
i niTiaTive , Department of Criminal Justice,
University of Nebraska (2004).

­
141

CHAPTER 9

40. See, e.g., State v. Kinder, 942 S.W.2d 313
(Mo. 1996); United States v. Porter, 618 A.2d
629 (D.C. 1992); People v. Axell, 235 Cal. App.
3d 836 (Cal. App. 1991).
41. See, e.g., Budowle. B., et al., Clarification
of Statistical Issues Related to the Operation of
CODIS, Pub. No. 07-01, Laboratory Division, Federal Bureau of Investigation (2006) (unpublished
manuscript) [hereinafter Budowle et al. (2006)],
http://www.promega.com/~/media/files/resources/
conference%20proceedings/ishi%2017/oral%20
presentations/budowle.pdf?la=en.
42. See, e.g., National Research Council, The
Evaluation of Forensic DNA Evidence, at 134
(1996) (NRC II) (“There is an important difference
between [a standard DNA case] and one in which
the suspect is initially identified by searching a
databank to find a DNA profile matching that left
at a crime scene. In the latter case, the calculation of a match probability or LR [likelihood ratio]
should take into account the search process.”);
DNA Advisory Board, Statistical and Population
Genetics Issues Affecting the Evaluation of the
Frequency of Occurrence of DNA Profiles Calculated From Pertinent Population Databanks
(Feb. 23, 2000) (clarifying that random match
probability and the statistical significance of
databank matches are distinct concepts requiring
different calculations); Stockmarr, A., “Likelihood
Ratios for Evaluating DNA Evidence When the
Suspect Is Found Through a Database Search,”
55 B iom e TR iCS 671, 671 (1999) (observing “distinction” between differing statistical considerations
necessary to derive statistical significance in
two types of cases); Devlin, B., “The Evidentiary
Value of a DNA Database Search,” 56 B iom e TR iCS
1276 (2000) (echoing Stockmarr’s position).
43. NRC I was composed of a professor of medical genetics; a professor of medicine, biochemistry and cell biology; two directors of forensic
science laboratories; a chemical engineer; a
professor of epidemiology and genetics; a professor of biology; a professor of law and sociology; a molecular geneticist; a J.D.-M.D. ethicist;
a professor of forensic sciences and biomedical
sciences; and a U.S. district court judge. See
National Research Council, The Evaluation of
Forensic DNA Evidence (1992) at 173-76 (NRC I).
44. See www.cstl.nist.gov/biotech/strbase/
multiplx.htm; Krenke, B.E., et al., “Validation

142

of a 16-Locus Fluorescent Multiplex System,”
47(4) J. f oR e nS iC S Ci. 773 (2002); Collins, P.J.,
et al., “Developmental Validation of a SingleTube Amplification of the 13 CODIS STR Loci,
D2S1338, D19S433, and Amelogenin: The AmpFlSTR Identifiler PCR Amplification Kit,” 49(6)
J. f oR e nS iC S Ci. 1265 (2004).
45. Butler, J.M., et al., New Autosomal and
Y-Chromosome STR Loci: Characterization and
Potential Issues, presented at P R om e ga S ym PoS ium
o n h um an i de nTifiCaTion (October 2007).
46. National Institute of Standards and Technology, New STR Loci Under Development by the
NIST Forensics/Human Identity Project Team,
available at www.cstl.nist.gov/biotech/strbase/
newSTRs.htm (last visited Jan. 17, 2008).
47. NRC II (1996), supra note 43, at 134.
48. Id. at 32.
49. Id.
50. See DNA Advisory Board (2000), supra note
43.
51. See Balding, D.J., and P. Donnelly, “Evaluating DNA Profile Evidence When the Suspect Is
Identified Through a Databank Search,” 41(4) J.
f oR e nS iC S Ci. 603 (1996).
52. Id. at 605.
53. See Budowle et al. (2006), supra note 42.
54. See, e.g., United States v. Jenkins 887 A.2d
1013 (D.C. 2005); People v. Nelson, 48 C aL . R PTR .
3d 399 (Cal. App. 2006), review granted, 147
P.3d 1011; People v. Nelson, 48 C aL . R PTR . 3d
399: Subsequent appellate history contains
negative analysis. Review granted, Depublished.
See also, People v. Johnson, 139 Cal. App. 4th
1135 (2006).
55. See Devlin, B., “The Evidentiary Value of
a DNA Database Search,” 56 B iom e TR iCS 1276
(2000); Amicus Brief in People v. Nelson; Letter
Brief of California Attorneys for Criminal Justice
in People v. Johnson, Exhibit B, Letter to the
Honorable Frederick K. Ohlrich, signed by 25
scientists. (It is a scientific manner to answer
“the central and oft-presented question in a DNA

DNA

INITIATIVE

DElAyED PRosECuTions AnD ColD CAsE HiTs

database match case, ‘What is the likelihood that
a match found between a known DNA profile
and a profile found by a search of a DNA database is merely coincidental.’” Though not always
agreeing on the direction of the effect, the scientists agreed that “[t]he fact that a suspect is
first identified by searching a database unquestionably changes the likelihood of the match
being coincidental.”) See also, Stockmarr, A.,
“Likelihood Ratios for Evaluating DNA Evidence
When the Suspect is Found Through a Database
Search,” 55 B iom e TR iCS 671 (1999).
56. See, e.g., Transcript, People v. Robinson,
J.N.6, p. 1581; J.N.3, p. 634 (testimony of prosecution experts); Letter Brief of California Attorneys for Criminal Justice in People v. Johnson,
Exhibit B, Letter to the Honorable Frederick K.
Ohlrich, signed by 25 scientists.
57. See generally, NRC II at 122 (1996) (setting
forth Recommendation 4.1 for calculation of profile frequency).
58. Kathryn Troyer, K., et al., A Nine STR Locus
Match Between Two Apparently Unrelated Individuals Using AmpflSTR Profile Plus and COfiler,
P R om e ga 12T h i nTe R naTionaL S ym PoS ium (2001),
available at http://www.promega.com/
~/media/files/resources/conference%20
proceedings/ishi%2017/oral%20presentations/
budowle.pdf?la=en.
59. See National Institute of Justice, U.S. Department of Justice, The Future of Forensic DNA
Testing, at n. 13 (Nov. 2000) (reporting 10 sixlocus DNA profile matches in the New Zealand
databank of 10,907 records, in which eight
matches were brothers, and two matches were
unrelated persons); Willing, R., “Mismatch Calls
DNA Tests Into Question,” u S a T oday (Feb. 8,
2000), at 3A (a coincidental six-locus match in a
United Kingdom databank).
60. See Ungvarsky, E., “What Does One in a
Trillion Mean?” 20(1) g e ne W aTCh (Jan.-Feb. 2007).
61. Arizona Department of Public Safety Crime
Laboratory, 9+ Locus Match Summary Report
(Oct. 2005).
62. For the original nine-loci match, RMPs
were 1 in 754,100,000 in Caucasians and 1 in
561,500,000 in African-Americans.

DNA

INITIATIVE

63. See Budowle et al (2006), supra note 42,
at 7.
64. See Paoletti, D.R., et al., “Assessing the
Implications for Close Relatives in the Event of
Similar but NonMatching DNA Profiles,” 46 J uR im e TR iCS J. 161 (2006); Weir, B., “Matching and
Partially-Matching DNA Profiles,” 49 J. f oR e nS iC
S Ci. 1009 (2004).
65. See Weir, B., “The Rarity of DNA Profiles,”
1(2) a nn . a PPL . S TaTS . 358-370 (2007), available at
http://projecteuclid.org/euclid.aoas/1196438022;
see also Buckleton, J.S., C.M. Triggs, and S.J.
Walsh, eds., Forensic DNA Evidence Interpretation: Biology, Technology, and Genetics of STR
Markers, at 460-462 (CRC Press, 2005).
66. See Ungvarsky, E., “What Does One in a Trillion Mean?” 20(1) g e ne W aTCh 12 (Jan.-Feb. 2007).
67. See, e.g., Order of the Honorable Vincent
Gaughan, Circuit Court of Cook County, Illinois
(July 11, 2006); Order of the Honorable Steven
I. Platt, Circuit Court for Prince George’s County,
Maryland (Aug. 4, 2006).
68. Dolan, M., and J. Felch, “The Verdict Is Out
on DNA Profiles,” L.a. T im e S (July 20, 2008).
69. For a discussion, see Murphy, E., “The New
Forensics: Criminal Justice, False Certainty, and
the Second Generation of Scientific Evidence,”
95 C aL . L. R e v . 721, 783 (2007).
70. See, e.g., Budowle et al. (2006), supra note
42.
71. See People v. Nelson, 185 P.3d 49 (Cal.
2008); United States v. Jenkins, 887 A.2d 1013
(D.C. 2005).
72. www.dbc.uci.edu/~mueller/pdf/leskie_
decision.pdf.
73. See Thompson, W., “Tarnish on the ‘Gold
Standard’: Recent Problems in Forensic DNA
Testing,” C ham Pion m agazine (Jan./Feb. 2006),
available at www.nacdl.org/public.nsf/0/
6285f6867724e1e685257124006f9177; see also,
www.bioforensics.com/articles/Kranereport.pdf.
74. Id.

­
143

CHAPTER 9

75. Id.
76. Id.; Murphy, E., “The New Forensics: Criminal Justice, False Certainty, and the Second Generation of Scientific Evidence,” 95 C aL . L. R e v .
721, 755 n. 151 (2007).
77. See Banks, A., “DNA Lab Admits Rape Case
Bungle,” T he a uS TR aLian (March 16, 2006),
available at www.dbc.uci.edu/~mueller/pdf/
australia_pathwest_false_match2.pdf.

144

78. See Precious, T., “Crime Lab Lambasted
Over DNA Database,” T he B uffaLo n e W S (April
25, 2006).
79. See Bryan, B., and R. Patrick, “Snitch’s
Death Frees Murder Suspect,” S T . L ouiS
P oS T -diS PaTCh (Jan. 11, 2006).

DNA

INITIATIVE

CHAPTER 10

Proactive Uses of DNA
Section 1: Using DNA to
Establish Third-Party Guilt
Recent advances in DNA technology —
particularly the standardized and widespread use
of STR typing and Y-STR DNA testing — have
made it possible to acquire and test DNA from
incredibly minute samples of biological material, including transferred skin cells, traces of
saliva and cells contained in sweat. Practically
any item handled or used by the perpetrator of
a crime can be subjected to DNA analysis in an
effort to obtain his or her DNA profile. These
items include weapons, hats, bandanas, masks,
eyeglasses, facial tissues, toothpicks, cigarettes,
tape, ligatures, bottles, cans, glasses, swabs
of bite marks, fingernail clippings or scrapings,
and even half-eaten food.1 A DNA profile can be
generated from testing seemingly invisible sweat
and skin cells from the inside of a baseball cap
worn by an assailant or on a knife an assailant
used to inflict fatal stab wounds. In cases where
a perpetrator forcefully removed a victim’s underwear or pants, DNA testing can be performed on
the waistband or cuffs that he or she grabbed
when pulling off the clothing.
As a result, DNA testing is now performed on
a wide range of evidence and in cases that go
beyond the framework of a rape case, where
semen and hair are collected from the victim.2
Just as DNA is a powerful tool for the prosecutor, it can be a powerful tool for the innocent
defendant. DNA test results showing the presence of DNA from someone other than the
accused on probative evidence can provide powerful scientific support that someone else may
have committed the crime.

DNA

INITIATIVE

Exclusion from a probative item
Depending on the facts of a case, a single exclusionary result may be sufficient to establish that
the defendant did not commit the crime — for
example, testing a cigarette butt the police collected from the crime scene in a case where the
assailant was seen smoking, or testing saliva
from a bite mark in a rape case where the perpetrator bit the victim.
When testing a single piece of evidence, it may
be helpful to test several key areas of the item
to help place the results in context and thereby
show that the DNA belongs to someone other
than the defendant. If, for example, a shirt left
at the crime scene is attributed to the assailant,
DNA testing can be performed on areas that
would contain the sweat and skin cells of someone who wore the shirt, including the inside
surfaces of the neck, cuffs and underarms. Test
results that exclude the defendant and establish
that the same unknown person contributed the
DNA profiles from each area of the shirt would
form powerful evidence that the person whose
DNA profile was found is the person who wore
the shirt — not someone who came into casual
contact with it. In a similar fashion, testing a ski
mask worn by an assailant and discarded at the
crime scene can generate a DNA profile from
sweat, skin cells and dandruff on the inside surfaces of the mask’s head area and from saliva
around the mouth.

Redundancy
In some cases, testing only a single piece of
evidence will be insufficient to argue third-party
guilt because the evidentiary significance of the
evidence — that is, whether the DNA on the
item came from the perpetrator or some other
source — is unclear. Take, for example, a case in

145
­


CHAPTER 10

which the victim was bludgeoned to death with
a hammer. DNA testing can be performed on
skin cells and sweat from the hammer’s handle.
However, because there is no way to know for
certain whether the biological material on the
hammer comes from the assailant or someone
who previously used the hammer, the prosecution may easily explain away the finding of DNA
from someone other than the defendant.
In such a case, redundant results — results
showing that the same DNA profile is on a number of items of crime scene evidence — may be
critical to the argument that the DNA found on
the various items, which does not belong to the
defendant, comes from the person who committed the crime. In the previous example, the probative value of the DNA from the hammer handle
could be transformed by results that show this
profile is consistent with DNA found under the
victim’s fingernails. The more redundant the
profiles are from the evidence, the stronger the
argument will be that the DNA came from the
perpetrator and not someone unrelated to the
crime.
Case example: Larry Peterson. In 1987, a victim’s partially clad body was found in a southern
New Jersey soybean field. She had been manually strangled, and her legs were spread apart with
her jeans and underwear pulled down toward her
ankle on one leg. Police learned that, in the hours
before her murder, the victim had consensual
sex with two men.
A local man, Larry Peterson, was arrested within
weeks of the crime and later convicted of felony
murder based on:

146

■■

Testimony from four individuals who claimed
that Peterson confessed (the alleged confessions contained nonpublic details of the
crime).

■■

Testimony from a state forensic expert that
seven hairs found on the victim’s body and a
stick that was used as a weapon were microscopic matches to Peterson.

■■

Testimony from three witnesses who claimed
that, in the days after the murder, they saw
fresh fingernail scratches on Peterson’s arm.

■■

Peterson allegedly threatened a witness and
tried to borrow money to leave town.

During the original investigation of the crime,
semen and sperm were found on the victim’s
pants, but none was detected on any of the
victim’s body orifice swabs. DNA testing was
not performed before the trial, as forensic DNA
testing was in its infancy at the time. The state
opposed postconviction DNA testing, arguing
that DNA would not shed light on the perpetrator’s identity because the victim had consensual
sex with at least two people immediately before
her rape-murder. The Appellate Court of New
Jersey subsequently ordered DNA testing under
the state’s DNA testing statute (N.J.S.A. 2A:
84-32a).
The DNA results showed that the hairs that had
been microscopically matched to Peterson actually belonged to the victim. DNA from someone
other than Peterson — an “unknown male” —
was found under the victim’s fingernails. STR
testing of the victim’s oral and vaginal swabs
showed sperm from two males, which had been
overlooked during the original examination. The
majority of the sperm from the victim’s vaginal
swab, as well as the sperm from inside the victim’s mouth, matched the profile of the unknown
male whose DNA was found under the victim’s
fingernails. Reference samples from the victim’s
two prior consensual sex partners were tested.
One partner was identified as the minor source
of sperm from the victim’s vaginal swab, and he
was the only source of the sperm on the victim’s
underwear and pants. The “unknown male’s”
sperm — although in the victim’s vaginal swab
sample — was not on her underwear or pants.
Because semen drains from the vaginal cavity
after intercourse, the fact that there was sperm
from the unknown male in the victim’s vagina,
but not on her underwear or pants, provided
powerful proof that (1) he was the last person to
have vaginal intercourse with the victim before
she was killed, and (2) the victim did not put
her clothing back on after intercourse with the
unknown male. As the unknown male’s sperm
was also found in the victim’s mouth and his
DNA was found under her fingernails, the test
results provided powerful scientific evidence that
the unknown male — not Peterson — vaginally
and orally raped the victim and strangled her. On
the basis of these redundant results, Peterson’s
conviction was vacated and the charges against
him dismissed.3

DNA

INITIATIVE

PRoACTivE UsEs of DNA

Note: When testing for redundancy, it is critical to take into account that different DNA tests
generally use different genetic markers. STR and
Mini-STR results share significant genetic markers and can be compared with one another. On
the other hand, Y-STR test results can be compared only with Y-STR test results, and mtDNA
test results can be compared only with mtDNA
test results. Competing goals are sometimes
encountered when testing DNA — for example,
the desire to obtain an STR profile that can be
searched in CODIS, the goal of getting redundant
test results, and the need to use Y-STR testing
on samples with a high female-to-male DNA
ratio. This may require testing all of the evidence
with the type of test needed for one item or subjecting a certain item to more than one type of
test.
Take, for example, a case in which a female victim is murdered by ligature strangulation. A DNA
profile will be obtained from fingernail scrapings
and the ligature collected at the scene. If the laboratory’s quantitation shows a low level of male
DNA in the fingernail samples, Y-STR testing
may be required to yield a profile. Because one
goal of testing is to obtain a profile searchable in
CODIS, and Y-STR results cannot be searched in
CODIS, the ligature could be subjected to STR
testing. However, to support the theory that the
person whose DNA was found under the victim’s
fingernails is the person who strangled her with
the ligature, the male DNA found underneath the
fingernails will need to be compared to the male
DNA on the ligature. One solution is to perform
both types of testing on the ligature: STR testing
to get a CODIS-searchable profile and Y-STR testing to obtain results that can be compared with
the Y-STR profile from the victim’s fingernails.

evidence to another unsolved crime or to an individual whose profile is in the databank.
Case example: Clarence Elkins. Clarence Elkins
was convicted in 1999 for the rape and murder
of his mother-in-law and the rape of his 6-yearold niece. The young victim reported that the
attacker looked like her Uncle Clarence. Results
from pretrial mtDNA testing of pubic hairs found
on the victims’ bodies excluded Elkins as the
contributor. Nevertheless, Elkins was convicted
and sentenced to life in prison on the basis of the
young victim’s identification.
In 2004, postconviction Y-STR DNA testing was
performed. The results showed a male DNA
profile on the victim’s vaginal swab that matched
DNA on portions of the girl’s underwear, which
the assailant had touched when pulling it off.
Elkins was excluded, but his motion for a new
trial based on the DNA results was denied.
Elkins’ wife, working with a private investigator,
learned that a convicted rapist named Earl Mann
had been living near the victim’s house at the
time of the crime. Mann was coincidentally transferred to Elkins’ cell block in 2005. Elkins picked
up a cigarette butt that Mann dropped in the yard
and mailed it to his wife. When the cigarette butt
was tested, it matched the crime scene DNA.
Elkins was exonerated in 2005 after serving six
and a half years in prison. Mann pled guilty to
charges related to the case.4
The following examples show how DNA can
provide essential corroboration of a third-party
confession previously deemed unreliable:
■■

Ryan Matthews was convicted and sent to
death row in Louisiana for the 1997 shooting of a store owner by a masked assailant.
Another inmate, incarcerated for a different
murder, bragged about committing the murder
for which Matthews was falsely convicted.
DNA testing of the mask matched the profile
of the other inmate, and Matthews was
exonerated.5

■■

Marvin Anderson spent 11 years in a Virginia
prison for a rape he did not commit. Years
before the postconviction DNA testing took
place, Otis Lincoln had confessed at Anderson’s habeas corpus proceeding that he — not
Anderson — had committed the crime, but

Matching crime scene evidence to
a specified third party
It is well-established that a defendant is entitled
to introduce evidence that another person committed the crime with which the defendant is
charged. Both before trial and after conviction,
DNA test results can link crime scene DNA to a
third party by comparing the DNA profile of an
alternate suspect with crime scene evidence or
through a CODIS hit that matches crime scene

DNA

INITIATIVE

­
147

CHAPTER 10

the reviewing court found Lincoln’s confession
unreliable. It was only after postconviction
DNA testing excluded Anderson and matched
Lincoln in the DNA databank that Anderson
was exonerated and Lincoln was tried and
convicted for the rape.6
■■

■■

Christopher Ochoa falsely confessed and pled
guilty to the 1988 rape-murder of a woman
in Texas. He also falsely implicated his friend
Richard Danziger. Ochoa and Danziger were
exonerated more than a decade after their
convictions when Achim Marino wrote to
then-Governor George W. Bush, confessing
that he alone committed the murder. Marino’s
confession was corroborated by DNA testing
that linked him to semen found in the victim’s
body.7
Five youth in the infamous “Central Park Jogger” case falsely confessed to beating and
raping a woman in New York’s Central Park in
1989. Thirteen years after the crime, Matias
Reyes admitted that he alone had committed
the terrible crime, and DNA testing showed
that the semen recovered from the crime
scene did, in fact, belong to Reyes. The convicted youth were then exonerated.8

Laboratory policies differ as to whether the lab
will perform a CODIS search at the request of
the defense. If a lab will not run a search at the
defense’s request — or the lab policy, state
laws, or CODIS user regulations prevent such
a search — counsel should seek prosecutorial cooperation or a court order. At least three
states — Georgia,9 Illinois10 and North Carolina11
— have statutory provisions that explicitly allow
a defendant to obtain a court order to search an
unknown DNA profile in the DNA databank upon
showing that access to the databank is material
or relevant to the defense.
Although a defendant’s right to demonstrate
third-party guilt through a CODIS search is a
novel issue, at least one appellate court has
addressed it in the context of an application for
DNA testing under New Jersey’s DNA access
statute (N.J.S.A. 2A:84A-32a). In State v. DeMarco,12 the Appellate Division of New Jersey ruled
that a convicted defendant was entitled to retest
semen evidence — from which he was excluded
before trial — with STR DNA technology for the
purpose of conducting a CODIS search to prove
third-party guilt.

148

When obtaining a court order for a CODIS
search, it is important to determine the scope
of the search. Will the crime scene evidence be
permanently uploaded into CODIS, or will a keyboard search be performed? A keyboard search
is a one-time search that compares the crime
scene DNA profile with all profiles on file at that
particular time in the databank. Every day, new
samples from convicted offenders and unsolved
crimes are added to the databank, increasing
the possibility of getting a hit. A sample must be
permanently uploaded for it to be compared with
new samples as they are added to the system.
Full profiles, partial profiles (deemed allowable)
and data from mixed samples (deemed allowable) can be searched in CODIS (see Chapter 7,
Section 12). The FBI governs searches of the
national databank, whereas state law governs
statewide databanks — the requirements may
not be the same. Even if a profile is not eligible
to be permanently uploaded (in either the national or a state databank), it may still be possible to
perform a one-time keyboard search depending
on the suitability of the sample for searching.
Similarly, if a profile does not qualify for uploading to the national or state databanks, it may still
be possible to search it against a local databank.

Section 2: When to Seek
Postconviction DNA Testing
Postconviction DNA testing can yield results that
scientifically establish a defendant’s innocence,
entitle him or her to a new trial, or mitigate the
sentence. Postconviction testing should be considered in cases where:
■■

A defendant was convicted prior to the routine
use of DNA testing.

■■

The conviction occurred after the advent of
DNA generally, but new DNA technology may
enable more meaningful results or testing of
previously unsuitable evidence (such as an
assailant’s sweatshirt).

■■

Testing might link DNA from the crime scene
to an alternate suspect.

In deciding which items to test, it is important
to consider all of the items that the perpetrator
would have used or touched.

DNA

INITIATIVE

PRoACTivE UsEs of DNA

Case example: Stephan Cowans. In 1997,
a Boston police officer pursuing a man acting
suspiciously was shot after the two scuffled and
the officer lost his gun. The assailant forced his
way into a nearby house, where he asked the
occupant for a glass of water and removed his
sweatshirt before fleeing. Stephan Cowans was
convicted of the shooting on the basis of eyewitness identification by the surviving victim/officer
and testimony by two fingerprint analysts, who
stated that a fingerprint taken from the mug from
which the assailant drank matched Cowans’
fingerprint.
In 2004, STR DNA testing was performed on
saliva from the mug and on sweat and skin cells
from both the sweatshirt and the brim of a baseball cap that fell off the assailant’s head and was
found in a nearby yard. The testing yielded the
same STR DNA profile on all three items. The
DNA results conclusively excluded Cowans as
the source and led officials to review and reject
the earlier, erroneous fingerprint analyses. In
2004, Cowans was released from prison upon a
joint motion by the prosecution and defense.13
In a postconviction case in which the defendant
maintains he or she is not the person who committed the crime, it will generally be insufficient
to simply show that the defendant’s DNA was
not at the scene. The defense will be looking
for testing to yield a DNA profile from the crime
scene evidence that is attributable to the perpetrator and does not match the defendant’s
profile.
Take, for example, a rape case in which the
defendant maintains he was misidentified and
the victim’s rape kit was not examined before
the trial. DNA test results from the rape kit that
yield only the female victim’s DNA profile would
be of little probative value. After a conviction, the
absence of the client’s DNA alone will be insufficient. (Note that, before the trial, such results
may have been helpful to the defense theory.)
To help the defendant, testing will need to show
a male DNA profile in the rape kit that does not
match the defendant or any other previously
identified consensual partners. For example, in In
re Pers. Restraint of Bradford,14 the defendant’s
conviction for a 1996 attack was vacated in 2005
after DNA testing performed on a piece of tape
— used by the perpetrator to adhere a mask covering the victim’s face — generated a male DNA
profile that excluded the defendant.

DNA

INITIATIVE

However, in cases where the state used biological or physical evidence at trial against the defendant, DNA test results that show the defendant’s
DNA is not on the item attributed to the assailant
may warrant a new trial on the basis of newly
discovered evidence. For example, consider a
rape case in which the state’s evidence consisted primarily of the victim’s identification of
the suspect. The state also used microscopic
hair comparison analysis that linked the defendant to a hair fragment from the victim’s rape
kit. Postconviction mtDNA analysis excludes the
defendant from the hair fragment and shows
instead that the hair’s mtDNA profile is consistent with the victim. Although the results do not
establish innocence — in the sense that they do
not exclude the defendant from evidence belonging to the assailant — they do show that the
defendant was convicted on the basis of false
evidence and may be entitled to a new trial.
In some cases, exclusionary test results can provide key support for defense theories — other
than factual innocence — that could minimize the
defendant’s culpability or mitigate the sentence.
For example, the defendant is charged with
murder for allegedly entering the victim’s home
with an accomplice and shooting the victim. The
defendant maintains that he only gave his friend
a ride to the victim’s house, but never entered
the house and was not the shooter. Pretrial testing of the defendant’s shirt was presumptive
for blood, and the blood was attributed to the
victim and used to establish the defendant as the
shooter. DNA results that exclude the victim as
the source of the DNA on the defendant’s clothing would provide support for the defense theory
that he did not enter the house and was not the
shooter.

Pretrial examination, testing and
DNA analysis
It is extremely important to keep in mind how
items may have been handled if they were used
as exhibits in court. For example, if seeking to
demonstrate that the client’s DNA is not on
items of evidence from the victim, but the court
record indicates that the defendant was handed
each item to review before it was published to
the jury, pursuit of the DNA testing may have a
detrimental effect on the postconviction process.
Using this example, finding trace amounts of the

­
149

CHAPTER 10

defendant’s DNA during postconviction testing
on these items wouldn’t be particularly surprising, but would be extremely hard to overcome
once detected. The handling of evidence after
crime lab processing without taking care to avoid
transfer of material between suspect, crime
scene and victim-associated evidence is common — particularly during pretrial preparation by
both sides and in the courtroom. Individuals handling evidence have not been required to wear
a particle mask to avoid inadvertently depositing
their DNA on an item, nor have individuals been
required to change gloves prior to handling each
new item of evidence. Most scientists will not
handle evidence in court without wearing gloves.
When considering what items to submit for testing, it is important to understand the scope of
the original examination of the evidence, if any,
and the implications of any negative findings.
For example, in the pre-STR DNA era, testing
was not typically done for sweat or skin cells on
clothing or weapons. (Clothing may have been
deemed significant and tested if it contained
blood.) There is no way to know whether clothing or weapons contain skin cells or sweat for
DNA testing until they are subjected to DNA
analysis. Also, before the advent of DNA testing,
there would have been no way to tell if material
under the victim’s fingernails contained foreign
DNA unless there was ample blood or tissue,
which could be tested to determine blood or
enzyme types or obtain an RFLP DNA, or other
DNA profile using a now-obsolete DNA testing
technique.
It is not uncommon for re-examination and testing of evidence to detect semen, sperm or other
important biological evidence that was undetectable or simply overlooked during the original
examination of the evidence. The National
Institute of Justice (NIJ) has endorsed the
re-evaluation of evidence, noting:
It may be important to re-evaluate/analyze
previously collected evidence samples to
determine if there are: (1) other relevant evidence samples that could be tested ... ; (2)
samples containing stains or other biological
samples that had not been detected previously; or (3) samples that were unsuitable
for testing with previous techniques but
may give conclusive results with currently

150

available DNA tests (e.g., very small blood
or semen stains, hair shafts).15

The no-semen fallacy
Due to the traumatic nature of sexual assault,
a rape victim’s perception and recollection of
events may be impaired. Many times, rape victims believe that the perpetrator did not ejaculate
when, in fact, ejaculation did occur.
It is important to consider the crime scene evidence anew and not rely on a previous negative finding that indicates there is no biological
evidence to test. Both the scientific literature
and individual DNA exoneration cases have confirmed the importance of re-examining evidence
in sexual assault cases. Early technology used
to detect the presence of semen frequently produced false negatives; newer tests are far more
discerning.16 For example, in a rape case in which
no semen or sperm were detected during the
original examination of the rape kit specimens, it
is possible that the semen or sperm were simply
overlooked. Despite an original negative finding,
male DNA could still be present in skin cells or
from pre-ejaculate left behind during sexual contact, which may contain low levels of semen or
sperm cells. Conventional serologic tests, such
as the p30 test, have a sensitivity threshold that
may not be low enough to detect semen at low
levels. Additional tests for the presence of male
DNA are now available, such as using the quantitation kits that target human male DNA during
the quantification step of DNA typing, that provide a more definitive answer as to the presence
or absence of male DNA on swabs and other
samples contained within a sexual assault kit.
Case example: Michael Mercer. Because testimony at Michael Mercer’s 1992 rape trial stated
that vaginal swabs taken from the victim had
tested negative for sperm, Mercer’s motion for
postconviction DNA testing was denied on the
grounds that additional testing would be pointless, as there was no semen from the perpetrator to test. However, in early 2003, unknown
to Mercer, the rape kit swabs from Mercer’s
case were sent to a private DNA laboratory with
whom New York City had contracted to test all
rape kits in its possession as part of a “backlog
project” to solve open cases through the DNA
databank. Despite the police chemist’s “negative” test for sperm in 1992, the DNA lab was

DNA

INITIATIVE

PRoACTivE UsEs of DNA

able to obtain a full STR DNA profile from spermatozoa detected on the vaginal swabs collected
from the victim in Mercer’s case. When the profile was entered into the databank, it produced a
hit to a convicted serial rapist. Mercer was exonerated and released from prison in May 2003.17
Case example: Ronnie Taylor. Ronnie Taylor
was convicted of raping a Texas woman in her
home in 1993. Police responded to the scene
less than an hour after the crime and identified
a “wet spot” on the bed sheet where the rape
occurred. A serologist testified for the state at
Taylor’s trial that testing of the bed sheet and
other evidence yielded “negative” results for the
presence of semen. In 2007, evidence from Taylor’s case was submitted for postconviction DNA
testing, and semen was found on the bed sheet.
Testing of the sperm yielded a profile that not
only excluded Taylor but also matched a man,
Chili Charlie, who was already in prison for other
sex crimes.18
Even in sexual assault cases where the assailant
did not ejaculate, traditional autosomal STR DNA
testing coupled with Y-STR testing may still be
able to generate the perpetrator’s DNA profile,
even if it is only a Y-STR haplotype, from skin
cells or pre-ejaculate left behind on clothing during intercourse or in a rape kit.
Case example: Dean Cage. In 1994, a 15-yearold girl was raped on her way to school in
Chicago. She identified Dean Cage as the perpetrator when police took her to a meat market
and asked her to identify the attacker. She also
identified Cage in a line-up by the sound of his
voice but was not entirely sure he was the man
who had raped her. The rape kit and other bodily
swabs as well as her clothing were tested for
DNA, but no sperm cells were revealed in the
initial examination. Postconviction Y-STR testing
revealed that the same male DNA profile was on
both the clothing and rape kit swab and that this
profile did not match Cage. He was exonerated
after serving 12 years of a 40-year sentence.19

Pretrial exclusion
Generally, postconviction DNA testing has little
use in cases where an older or less informative forensic science methodology excluded the
defendant as the source of the biological material

DNA

INITIATIVE

before the trial. For example, if the defendant
was excluded through microscopy as the source
of a crime scene hair, it would be of little use to
perform mtDNA testing to exclude the defendant
again (albeit with more informative and, in some
instances, reliable technology). However, there
are important circumstances in which testing evidence from which the defendant was excluded
can be the key to exoneration.
In some cases, law enforcement discount the
significance of crime scene evidence after the
prime suspect is excluded as the source of that
biological material. This commonly occurs in murder cases in which investigators initially believe
that the victim was also sexually assaulted but,
after excluding the accused as the source of
semen evidence, change their theory of the
crime, attribute the semen to prior consensual
sex, drop charges related to the sexual assault,
and instead focus solely on a prosecution for
homicide. In such cases, it can be critical to link
the evidence deemed insignificant by the state to
an alternative suspect. When prior serology (ABO
and enzyme typing) or older forms of DNA testing (for example, RFLP and PM/DQα) excluded
the defendant before trial, counsel should consider retesting the evidence with autosomal
STR technology to generate a profile that could
be searched in CODIS. Retesting could yield a
hit to a person convicted of a similar crime or
to an unsolved crime that was committed at a
time when the defendant could not have been
involved.
Case example: Jeffrey Deskovic. In 1989, the
body of a missing high school student was found
in the woods in Westchester, N.Y. The victim
had been strangled and beaten and was partially nude. During the investigation, sperm was
recovered from the victim’s body and submitted
for DQα testing. When the lead suspect, Jeffrey
Deskovic — a classmate of the victim who had
(falsely, but convincingly) confessed to the crime
— was excluded as the source of the sperm,
investigators deemed the biological material
unrelated to the murder, speculating that it originated from a prior act of consensual sex. Despite
the pretrial exclusion, Deskovic was convicted.
In 2006, the sperm evidence was retested with
STR technology, and the profile matched a man
in prison for a similar murder. On the basis of
these results, the Westchester County District

­
151

CHAPTER 10

Attorney’s Office moved to vacate Deskovic’s
conviction.20
Case example: Douglas Warney. In 1996, a
Rochester, N.Y., man was found stabbed to
death in his home. There were drops of blood
leading from the room where the victim’s body
was found to a nearby bathroom. Inside was a
bloody towel as well as blood in the sink. Douglas Warney was convicted of the crime almost
exclusively on the basis of a confession he gave
to police shortly after the crime (which contained
details known only to the killer and police). Serologic testing performed before the trial excluded
Warney as the source of nonvictim blood at the
scene. Nevertheless, prosecutors successfully
argued at trial that the blood could have come
from an accomplice, and Warney was convicted.
In 2006, the crime scene blood was retested
with STR technology, and the DNA profile was
entered into CODIS. There was a hit to a man
named Eldred Johnson, who was incarcerated
for various similar stabbing offenses. Johnson
confessed to committing the crime alone and
has since pled guilty.21
Aside from matching evidence to a specific
third party, defense counsel may want to test to
establish redundancy. For instance, a defendant
may have been convicted despite exclusion from
biological evidence before the trial because there
were alternate explanations for the significance
of the biological testing results. Current DNA
technology may not only confirm the exclusion of
the defendant but may also show that the same
DNA profile is on a separate piece of evidence.

Inconclusive or no results
Retesting with newer technologies should be
considered in cases where DNA testing was
inconclusive or failed to yield a result. For example, consider a case in which previous DNA testing — even autosomal STR testing — of a female
murder victim’s fingernails showed only the
victim’s profile. Retesting with Y-STR technology
could yield a haplotype profile of a foreign male
DNA source.

152

Limitations of non-DNA forensic testing
It is important to understand the limitations of
prior testing. For example, ABO blood typing
could include an individual only in a relatively
large segment of the population that could be
the source of the biological material. In general,
40 percent of the Caucasian population have
type A blood, 45 percent have type O blood,
11 percent have type B blood, and 4 percent
have type AB blood. Although the approximate
percentages of each blood type vary among
population groups, an overwhelmingly large
percentage of each population group has type
A or type O blood. However, even if someone
has type AB blood, statistically speaking that is
roughly 1 in every 25 people having that “rare”
blood type. In comparison to autosomal DNA
typing results, ABO testing, while useful in its
day, provided a limited ability to discriminate
among people in the population.
A trace evidence examination, such as microscopic hair comparison, is subjective and based
on class characteristics. Although still used to
screen hairs for DNA testing, microscopic hair
comparison analysis has never been considered
a conclusive form of identification. The appropriate interpretation of hairs that exhibit the same
microscopic characteristics is only association.22
A recent study of microscopic hair comparisons
found that, out of 80 “microscopic associations”
made independently by two top FBI examiners, nine were demonstrated to actually be
exclusions when later subjected to DNA testing (approximately 11 percent of the cases).23
Given the availability of DNA testing, the current
approach should be to support any associative
microscopic hair comparison results with nuclear
autosomal STR DNA typing when there is cellular
material on the root of the hair, or via mtDNA
testing when only a hair shaft exists or when
autosomal STR DNA testing fails to yield results.
Case example: Ron Williamson and Dennis
Fritz. In the cases of Ron Williamson and Dennis
Fritz, mtDNA testing contradicted the microscopic hair comparison analysis performed before
trial. Williamson and Fritz were convicted of the
1982 rape and murder of a woman in her Oklahoma home. Williamson received a death sentence;

DNA

INITIATIVE

PRoACTivE UsEs of DNA

Fritz received life in prison. A key element of the
state’s case was forensic expert testimony that
17 hairs from the crime scene microscopically
“matched” either Fritz or Williamson. The state’s
case appeared to be so compelling that Williamson’s appeals were quickly exhausted. He came
within five days of execution. However, in 1999,
Williamson received a last-minute stay of execution and obtained DNA testing, which proved
that none of the 17 hairs that were deemed
matches at the time of trial actually belonged to
Fritz or Williamson. These results — combined
with results excluding the men as the source of
semen collected from the victim — exonerated
both men and led to their release from prison.
DNA testing also led to the identification of the
true assailant: Glen Gore, a key state witness
who falsely incriminated Williamson. Gore was
convicted of the woman’s murder in 2003.24

Prior DNA testing that was “inculpatory”
Even if DNA testing was performed that did not
exclude the defendant, additional tests may be
warranted after conviction. NIJ guidelines for
handling postconviction DNA testing requests
point out that:
It is important to understand what the previous test results really mean and whether
those results could have been obtained if
another individual other than the alleged
donor was the source of the sample. For
instance, ABO blood testing and/or DQα
PCR test results alone are not sufficiently
discriminating such that a falsely accused
individual would necessarily be excluded
with these tests.25
For example, one earlier form of PCR-based DNA
testing — the DQα test — is akin to basic blood
typing in that:
As with serological tests, an exclusion with
[the DQα] test eliminates an individual as
the source of the sample; however, an
inclusion with this test simply includes an
individual within a set of a large number of
individuals that also have the same DNA
types. A falsely accused individual may be
included as a possible donor of a DNA sample with this test system.26

DNA

INITIATIVE

In such cases, requesting testing with more discriminating technology is appropriate. The cases
of Josiah Sutton from Texas and Jerry Watkins
from Indiana illustrate how indiscriminating
DQα testing is and how innocent people can be
included through DQα testing even though the
biological material did not come from them. Both
Sutton and Watkins were included as the source
of biological crime scene evidence through DQα
testing and convicted of sexual assaults. They
were later excluded through the more informative autosomal STR DNA testing and exonerated.
See the case profiles of Sutton and Watkins at
www.innocenceproject.org.

Cases involving multiple perpetrators
Postconviction DNA testing can yield material
exculpatory evidence and even prove innocence
in cases with multiple assailants. For example,
in a rape perpetrated by two assailants, a range
of possible test results could establish a defendant’s innocence. DNA testing of semen from
the rape kit may reveal two male DNA profiles
(belonging to each of the assailants). If two profiles are obtained and the defendant is excluded,
such test results would establish innocence.27
This same logic holds true for cases where there
are more than two assailants. In fact, many of
the postconviction DNA exoneration cases have
involved crimes committed by multiple perpetrators — as many as five or six assailants. Just
because testing may not yield the requisite number of profiles to demonstrate innocence is no
reason to forgo testing.

Prior consensual sex and the potential
need for an elimination sample
In some cases, after the defendant is excluded
during postconviction testing, it will be necessary
to obtain an elimination sample to establish that
the biological material actually belongs to the
assailant. For example, consider a case where
the defendant was excluded as the source of
sperm found on swabs in which the victim had
consensual sex the day of her attack. An elimination sample would be required from the prior
sex partner. If the sex partner is eliminated as a
source of the sperm, then it can reasonably be
inferred that the sperm came from the assailant

­
153

CHAPTER 10

— therefore, the defendant’s exclusion establishes innocence. If the sperm matches the consensual sex partner, then the test results may
entitle the defendant to a new trial (depending
on how the presence of sperm was used at trial)
but would not prove innocence. The potential
need for an elimination sample should not be an
obstacle to DNA testing.28 Elimination samples
were successfully obtained and used in many of
the DNA exoneration cases.
It is important to keep in mind that if the consensual partner is no longer available (perhaps he is
deceased), there are a number of possibilities
for locating a medical sample or a family member
willing to provide a sample for comparison
purposes.

■■

The evidence storage locations under each
agency’s control.

■■

Whether physical searches of those locations
were conducted or the agency relied only on
paper records to determine that evidence no
longer exists.

■■

If physical searches were conducted, who
performed the search.

■■

When this person (or people) performed the
search.

■■

What facilities, locations and areas were
searched within each agency.

■■

An inventory of what evidence items were
recovered.

■■

Contemporaneous business records documenting the destruction of any evidence that
the state maintains no longer exists.

■■

Copies of all other chain-of-custody documents, including evidence logs that reflect the
chain of custody from the time the evidence
was collected.

■■

Each agency’s procedures and policies for
storing evidence from the time of the crime
to the present.

Evidence searches
The most difficult step in the postconviction
DNA testing process can be locating the physical
evidence from the case to test. Defense counsel may need to track the chain of custody from
the time the evidence was collected and check
with every agency that possessed it. Evidence
can be found decades after a crime in a variety
of places, including the hospital, morgue, trial
or appellate courts, district or state’s attorney’s
office, police department, sheriff’s office, court
reporter’s office, and the laboratory that did the
original or any previous testing in the case. Every
jurisdiction has its own procedure for storing evidence. Finding evidence may depend on learning
these policies and procedures as well as where
evidence could be if there was a departure from
procedure. Counsel will want to learn all of the
locations where evidence is stored by agencies
that once possessed the evidence.
Ultimately, locating the requested evidence — or
determining that it has all been destroyed — will
depend on a competent, comprehensive search.
The jurisdiction must physically and thoroughly
search all facilities and locations that can reasonably be expected to store the evidence, and
it must produce chain-of-custody documents
and other information detailing its efforts to the
defense. At a minimum, the state should be
made to disclose:
■■

154

All agencies that might possess evidence from
the case.

If the state is unable to locate the physical evidence, the defense should seek a hearing to
determine the adequacy of the state’s search
and the availability of evidence.
Counsel can start the evidence search by calling or writing each agency to request voluntary
cooperation. The custodians of evidence or
records should be willing to look for evidence
upon request and share any documents pertaining to chain of custody. (Counsel can also
make a request for this information under the
jurisdiction’s public records law.) Each agency
has its own protocol for numbering cases; when
requesting a search for evidence or confirmation
that evidence exists, it is important to include
that number. For example, when calling the
crime laboratory, provide the laboratory’s case
number (as opposed to the indictment number,
which in most circumstances would be useless
to lab personnel looking for the evidence).
The defense must be clear in what it asks the
agency to look for and ensure that the agency
does not simply rely on paper records but

DNA

INITIATIVE

PRoACTivE UsEs of DNA

actually physically searches for the requested
evidence. For example, it is routine for laboratories to return original evidence, such as a rape kit
or the victim’s clothing, to the submitting agency
when the examination is complete. If counsel
contacts a lab and asks for evidence from the
case, the lab may say (and provide paperwork
indicating) that the evidence was returned to the
submitting agency many years ago. However,
labs frequently retain, or separate out, cuttings,
slides, swabs, extracts and other materials during the testing. Therefore, be clear in what you
ask for — it is always better to be overly inclusive because you do not know what evidence
might be available.
A flowchart that shows each step in evidence
processing may also be of value. You would
need to create it showing the type of evidence
category and the practices used when the case
was originally processed.
See below for some tips for various types of
agencies that may be of value when requesting
a search for evidence.

Hospital and medical examiners’
or coroners’ offices
After a rape, the victim is generally taken to a
hospital, where she is treated and a kit is used to
collect potential evidence. In addition to collecting samples for the kit, hospitals collect samples
for their own testing, such as for sexually transmitted diseases. Hospitals also have been found
to retain slides from their exam of the victim
(their patient) — in places such as the hospital’s
laboratory and pathology departments — even
decades after the original examination. In a similar manner, medical examiners’ and coroners’
offices may have also retained biological materials that are potentially suitable for analysis.
Case example: Bernard Webster. Bernard Webster was convicted of a 1982 Maryland rape on
the basis of three eyewitness identifications. In
2002, Webster was exonerated by postconviction DNA testing. Although the Baltimore County
Police Department had destroyed the case’s
biological evidence by the time Webster sought
postconviction testing, three slides from the victim’s rape examination were found at the pathology department of the Greater Baltimore Medical

DNA

INITIATIVE

Center, where the victim had been treated
immediately following her attack. DNA testing of
the 20-year-old hospital slides yielded an autosomal STR DNA profile that not only exonerated
Webster but also identified, through a search of
the DNA databank, the true perpetrator of the
crime.29
When asked whether they keep rape kits in general or in a specific case, hospitals will almost
always say no and explain that the evidence was
released to the police. The defense must make
clear that it is not asking for the rape kit but
rather duplicate slides or specimens made during
the exam for the hospital’s own use (as opposed
to law enforcement’s use). Due to privacy laws,
counsel will likely need a court order or subpoena
to require a hospital to search for any evidence
from the case.
In murder cases, an autopsy would have been
performed, and evidence from the victim’s body
and clothing would have been collected and,
typically, later released to law enforcement. As
with hospitals, the medical examiner’s or coroner’s
office may have retained slides or other specimens.

Investigating law enforcement agencies
After the rape examination, the investigating
agency (police or sheriff’s office) usually retrieves
the evidence from the hospital. In addition to the
rape kit, police frequently collect the clothing the
victim wore to the hospital. Police also collect
physical or biological evidence from the crime
scene. Typically, the law enforcement agency
submits some or all of the evidence to the crime
lab; evidence not submitted stays in the agency’s
custody. After the lab completes its examination, the submitting agency often retrieves the
evidence for long-term storage in its facility or
for transport to court for a legal proceeding. Evidence not used at trial may stay with the investigating agency indefinitely. Alternatively, the
law enforcement agency may follow a protocol
for destroying stored evidence on a prescribed
schedule.
Case example: Alan Newton. On July 6, 2006,
Alan Newton of the Bronx, N.Y., was freed after
22 years of wrongful imprisonment for rape.
Newton had been seeking DNA testing for 12
years, and both he and the court were told that

­
155

CHAPTER 10

repeated searches of police evidence facilities —
where the rape kit was last held in 1985 — had
yielded no evidence. In July 2005, a prosecutor
newly assigned to the case asked the commanding officer of the police warehouse to make a
renewed search. The prosecutor provided the
officer with documentation indicating the specific bin where the evidence had been stored 20
years ago. When a hand search of that bin was
performed, the rape kit was found inside it. DNA
testing of that evidence thereafter conclusively
proved Newton’s innocence, and he was exonerated by a joint motion by the defense and the
Bronx District Attorney’s Office.30

was told that the rape kit from his case had been
destroyed. A special search in 2001 by the director of the Virginia Division of Forensic Science
revealed that the criminalist who had performed
the conventional serology tests in Anderson’s
case in 1982 had broken lab protocol and, instead
of returning the slides containing semen samples
to the rape kit, had scotch-taped them into the
lab notebook. The combination of this breach of
procedure and the dedicated search led to the
discovery of evidence that, once subjected to
DNA testing, exonerated Anderson.

Crime laboratories

Depending on the jurisdiction, physical evidence
used at trial may be with the trial court, reviewing courts, prosecutor’s office or sometimes in
the custody of the court reporter, bailiff or judge.

Although crime labs typically return the original
evidence (such as a rape kit or clothing) to the
submitting agency after the examination is complete, they frequently will preserve and store cuttings, slides and swabs of evidence used during
testing. Such critical evidence has been found at
crime labs decades after the original exam. It is
important to have a crime lab check its evidence
vaults for retained items as well as all relevant
case files for evidence or chain-of-custody information. Crime labs that do not store these biological samples that are suitable for subsequent
DNA testing in their facility may have created a
packet or container that holds the samples and
submitted that to the investigating agency as a
newly created “item” of evidence.
Some crime labs will retain portions of the evidence for only a fixed number of years following
the original examination. Their policy or storage
limitations may have resulted in this evidence
being returned to the submitting agency. In
recent years, more and more crime labs have
been returning swabs, slides and cuttings that
had been retained at the lab. These portions
of the original items are often returned in bulk,
along with similar biological evidence from other
cases, to submitting law enforcement agencies.
This separate avenue for locating biological crime
scene evidence must be explored because the
packages containing the biological evidence cuttings, swabs and slides may not have been refiled with the original case evidence.
Case example: Marvin Anderson. When Marvin Anderson of Virginia sought DNA testing, he

156

Clerk of the court/trial court exhibits

Prosecutors’ offices
Evidence used in postconviction testing has been
found in district attorneys’ evidence storage
rooms as well as the district attorney’s trial file.

Postconviction evidence search —
treatment by courts
As noted above, when an agency asserts that
the evidence was destroyed, the agency should
provide contemporaneous records documenting
the evidence destruction. Even then, a physical
search must be conducted to ensure that the
order was carried out and all of the evidence
was, in fact, destroyed.
Absent conclusive proof that each item of potential biological evidence was destroyed, one or
more items capable of resolving the petitioner’s
guilt or innocence beyond any doubt may still
be in existence. In several DNA cases described
earlier, evidence that had been reported as lost
or destroyed was later discovered intact after
a more diligent search. Indeed, when evidence
has, in fact, been destroyed, there will usually
be specific documentation of the destruction of
every item, even if the evidence was destroyed
in bulk. If there is not, one simply cannot be confident that the evidence is truly gone.

DNA

INITIATIVE

PRoACTivE UsEs of DNA

Evidence has been located in the back of a storage closet, a trial judge’s locker, and between
a wall and a prosecutor’s desk. Sometimes evidence is labeled under the victim’s name rather
than the defendant’s name, or it is simply misfiled among unrelated case evidence boxes. In
other cases, it became clear after evidence was
located in the original storage location that prior
searches were half-hearted or perhaps not performed at all.
Although counsel can begin by contacting
facilities in the chain of custody and requesting
information, it may be necessary to litigate the
evidence search to locate the evidence. Counsel can make a motion under the jurisdiction’s
access statute. Many state statutes either explicitly provide for evidence searches or require the
court to make a factual determination regarding
the existence of the evidence. Counsel can file a
motion under the statute, requesting an evidence
search and testing of any evidence located.
Many state courts have ordered law enforcement agencies to conduct comprehensive evidence searches. These cases place significant
weight on NIJ’s 1999 report, DNA Testing: Recommendations for Handling Requests,31 which
notes that “[f]inding the evidence is the most
difficult part of the [DNA testing] process.”32 The
report cautions prosecutors against concluding
too hastily that evidence no longer exists and
advises prosecutors to “use their best efforts to
locate the crime scene samples.”33 The report
also notes that “[m]any times all parties believe
that the evidence has been destroyed, when in
fact it has not.”34 The report further states:
If, from initial contact with the investigating
officer or review of case files, it appears
that evidence suitable for DNA analysis
was never collected, or has since been
destroyed, it may prove impossible to
continue with the rest of this guideline. ...
However, no final decision or notification
should be made until it has been carefully
verified that evidence did not or does not
still exist.35
In ordering state agencies to conduct comprehensive evidence searches, courts have rejected
both unsworn affidavits that the evidence no longer exists and reliance on paper records without
physical searches, even when a comprehensive

DNA

INITIATIVE

physical search would require the state to inventory large evidence storage rooms.36
In Arey v. State, a Maryland appellate court ruled
that the state had the burden of establishing that
the evidence no longer existed. The state failed
to meet its burden by submitting an unsworn
affidavit after it briefly searched only one location
for the evidence. The court found that relying on
computer records and paper files alone — absent
a physical search — was insufficient to conclude
that the evidence no longer existed. According to
the court, “the [s]tate needs to check any place
the evidence could reasonably be found, unless
there is a written record that the evidence had
been destroyed in accordance with then-existing
protocol.”37
In Blake v. State, the court held that an “unsworn
memorandum, stating that the [s]tate merely
requested the police to look in the evidence control unit, is insufficient to establish this critical
fact,” adding that “[s]imply asking a police officer
to check an evidence unit locker is not sufficient.
There are many other likely places where the
evidence may have been stored.”38 Similarly, in a
New York case, it was held that the state is “the
gatekeeper of the evidence, who must show
what evidence exists and whether the evidence
is available for testing,” and the “mere assertion
that the evidence no longer exists based on a
phone call to a police [p]roperty [c]lerk’s office is
insufficient as a matter of law” to summarily dismiss a DNA testing motion.39
Moreover, the court in Arey described what a
search should entail. Simply put, “a court should
not conclude that evidence no longer exists until
the [s]tate performs a reasonable search for the
requested evidence.”40 The court explained:
At a minimum, a reasonable search ...
would have required the [s]tate to look
in the crime lab referred to in Detective
Russell’s testimony, if the lab is still in
existence, for any slides used to test the
blood evidence used against appellant or
for pieces of the clothing he requested; the
property room, if it was different from the
ECU; and because the testimony at trial
was that the evidence had been stored in
the Judge’s chambers, as unlikely as it is
that it would be there after all these years,
an inquiry as to that location.41

­
157

CHAPTER 10

Additionally, the appellate court held that the
state had a duty to identify whether the various
state agencies “had protocols in place for the
destruction of evidence” and, if so, whether
these agencies followed their respective
protocols:42
[I]t is reasonable to assume that police
departments, sheriff departments, clerk
offices of the court, and like departments
had protocols in place for the destruction
of evidence, even before the enactment of
[the DNA testing statute]. The [s]tate should
identify the protocol that was in place
from the time of the trial to the time of the
request for testing, if possible, and see if
that protocol was followed.43
The appellate court explained that the inquiry
into the protocols might lead to other locations
to search.44

Section 3: When Are You Entitled to
Postconviction DNA Testing?
Seeking state consent
In many cases, the state will consent to a defendant’s request for postconviction DNA testing,
obviating the need for unnecessary litigation. In
fact, the NIJ guidelines recommend that prosecutors avoid unnecessary litigation and consent
to testing in cases where an exclusionary result
would prove innocence.45 Even when a prosecutor agrees, it is important to proceed with a consent or stipulated order entered by the court that:

158

than 40 states and the federal government have
statutes that entitle defendants to access to
postconviction DNA testing.46 As many of these
statutes were enacted after 2000, prosecutors frequently consent either to testing or to a
motion under the statute, and courts routinely
order testing on opposed motions under state
statutes. However, there is not an abundance of
case law interpreting these laws. In this sense,
the DNA exoneration cases can provide powerful
support for a motion for DNA testing by illustrating how DNA can provide evidence of innocence
in a given case.
The requirements of state postconviction DNA
statutes vary. They use differing burdens of proof
requiring a defendant to show that favorable test
results would most likely change the verdict and
establish innocence.

Identity-at-issue requirement
Many DNA access statutes contain a requirement that the perpetrator’s identity was or
should have been an issue at trial. Some prosecutors and lower courts have misconstrued this
requirement to mean that the applicant must
show that the state’s identification evidence was
weak or the conviction was based mainly on
eyewitness identification testimony. However,
the identity-at-issue requirement has the same
meaning in the DNA context as it does elsewhere in criminal law.

State statutes on postconviction DNA access

The identity issue is present in every criminal
case in the sense that, to warrant conviction, the
evidence must establish beyond a reasonable
doubt the identity of the defendant as the person
who committed the crime. When asserting a
defense such as consent, self-defense, necessity, or insanity, the defendant admits that he
or she participated in the charged acts. In such
cases, the state still must prove the defendant’s
identity, but because the defendant admits participation, identity is not a genuinely contested
issue. On the other hand, when the defense is
misidentification, alibi or any other defense in
which the defendant disputes that he or she was
the perpetrator, identity is a significant issue.47

Postconviction testing can be obtained through
an application under the state’s postconviction
DNA-testing access statute. Currently, more

Whether the identity-at-issue requirement is met
in a particular case depends entirely on whether
the applicant for postconviction DNA testing put

■■

Provides for chain of custody of the evidence.

■■

Details the procedures to be used to collect
a new reference sample from the defendant
and disseminate the test results.

■■

Addresses the circumstances under which
the laboratory can use up the evidence during
testing.

DNA

INITIATIVE

PRoACTivE UsEs of DNA

forth a defense at trial that he or she was not the
person who committed the crime. The identityat-issue requirement is a common-sense limitation on postconviction DNA testing requests.48
The very purpose of the postconviction DNA
statute is to use more informative scientific technology to test the state’s identification proof —
proof a jury has already determined to be beyond
a reasonable doubt — to determine if a wrongful
conviction occurred. Generally, there would be
little point to test in cases where the defendant
admits that he was the perpetrator but maintains nevertheless that he is legally innocent.
For example, in a rape case where the defense
is consent, DNA testing would not resolve the
primary question: whether the victim consented.
Rather, DNA testing would be expected simply
to confirm a fact not in dispute: that the defendant had sexual contact with the victim.
In State v. Peterson, Peterson was convicted
of felony murder based on “strong evidence of
defendant’s guilt,” including:
■■

Testimony by three people that Peterson had
described the crime to them “in lurid detail”
only a few hours after the crime, before police
had released any detailed information to the
public.

■■

Testimony of an inmate in the jail where Peterson was incarcerated before trial. Peterson
allegedly admitted to the inmate that he had
committed the crime.

■■

In the days after the crime, Peterson had fresh
scratch marks that looked like fingernail marks
on his arms.

■■

After the crime, Peterson had asked several
people for money so he could travel to
Germany, and he threatened several potential
witnesses.49

The trial court initially found that the identityat-issue requirement was not met because the
case did not involve a stranger’s eyewitness
identification. The Appellate Division found that
the trial court erred in concluding that Peterson
had failed to show that identity was a significant
issue at trial, noting:
Eyewitness identification is simply one
method of proving a perpetrator’s identity.
The identification of the defendant also may
be established by various other forms of

DNA

INITIATIVE

evidence including, as in this case, the
defendant’s inculpatory statements and
efforts to avoid apprehension and physical
evidence found at the crime scene.50
The Appellate Division further stated:
[D]espite the strong evidence of his guilt,
defendant’s identity as the perpetrator was
the only issue at trial. Defendant took the
stand and denied that he was the one who
raped and murdered the victim. Moreover,
defendant presented his girlfriend’s testimony that he was with her in a motel room
at the time of the crime. Although this alibi
was discredited, defendant’s only defense
was that he was not the perpetrator of this
horrific crime.51

Reasonable likelihood of a different outcome
All statutes require an applicant to make some
sort of showing regarding the probative value
of favorable DNA test results in the case. New
York’s statute (C.P.L. 440.30(1-a)) requires the
applicant to show that if a DNA test had been
conducted on the requested evidence and the
results had been admitted in the trial resulting in
the judgment, there exists a reasonable probability that the verdict would have been more favorable to the defendant. Louisiana’s DNA statute
(La. C. Cr. P., article 926.1) requires an applicant
to show there is “a reasonable likelihood that the
requested DNA testing will ... establish the innocence of the petitioner.” Some statutes employ
a stricter standard. For example, Ohio’s DNA
statute (R.C. § 2953.74(B) & (C)) requires that
the DNA results be “outcome determinative with
respect to the question of [applicant’s] guilt.”52
The “reasonable likelihood” prong ensures that
the evidence to be tested has probative value.
Because it is impossible to know the outcome
of DNA testing in advance of actual testing, this
inquiry requires the court to presume favorable
test results and determine the significance of
those favorable test results — that is, whether it
is “reasonably likely” that favorable test results
would be probative enough to establish the applicant’s innocence.53 The “reasonable probability”
prong requires the court to consider the probative value of favorable test results on the case
— not whether it thinks it is likely, as a matter of
fact, that the applicant is actually innocent.

­
159

CHAPTER 10

Overwhelming evidence of guilt
As of July 22, 2010, there have been 255 DNA
exonerations in the United States. In many of
these cases, the trial evidence against the defendant could be characterized as overwhelming
— including cases where the defendant gave
a detailed confession or pled guilty; the state’s
evidence consisted of “certain” or multiple eyewitnesses; or other forensic evidence, even prior
DNA testing, that linked the defendant to the
crime.54 It is important to understand that properly conducted DNA testing is more accurate and
reliable than practically all other types of identification proof.55 The existence of overwhelming
evidence of guilt in a particular case should not
stand in the way of DNA testing.

Eyewitness identification
Eyewitness misidentification played a role in
more than 75 percent of convictions overturned
through DNA testing.
Case example: Michael Williams. Michael
Williams from Chatham, La., was convicted of
aggravated rape in 1981 on the basis of what
seemed to be an unassailable identification: the
eyewitness testimony of the victim, who had
known Williams since he was a little boy and
tutored him months before she was attacked.
The 22-year-old victim stopped tutoring 16-yearold Williams after he became infatuated with her.
Williams harassed her, broke a window at her
home, and was arrested as a consequence. Several months later, when a man entered her home
in the middle of the night and raped her, the
victim immediately reported that she was able to
see the assailant and identified Williams. However, in 2005, testing of semen from the clothing
the victim wore during the attack excluded Williams, and he was exonerated after 24 years of
wrongful imprisonment.56
Case example: Kirk Bloodsworth. Kirk Bloodsworth was convicted in 1985 in Maryland for
the sexual assault and brutal killing of a 9-year-old
girl. The victim had been strangled, raped and
beaten with a rock. Bloodsworth’s conviction
rested on five eyewitnesses, who testified at trial
that they had seen him with the victim before
she was murdered. Additional evidence against
Bloodsworth included:

160

■■

Testimony that he had said he did something
terrible that day that would affect his relationship with his wife.

■■

Bloodsworth’s mention of a bloody rock to
police before that information had been made
public.

■■

A shoe impression that matched his size,
found near the victim.

In 1992, the prosecution agreed to DNA testing
of the victim’s shorts and underwear, a stick
found at the scene, and an autopsy slide. Testing
of sperm on the victim’s panties excluded Bloodsworth. After spending more than eight years in
prison — two of those years facing possible execution — Bloodsworth was released from prison
and pardoned. However, even though prosecutors deemed Bloodsworth’s exclusion from the
semen evidence sufficient to overturn his conviction, it was not until 2003, when the evidence
was retested with autosomal STR technology
and matched through CODIS to a convicted sex
offender named Kimberly Shay Ruffner, that the
state finally acknowledged Bloodsworth’s innocence. At the time of the DNA hit, Ruffner was
in prison for an attempted rape and murder he
committed just three weeks after the 9-year-old
girl’s murder.57
Case example: Kevin Green. In 1980 in California, Kevin Green was convicted of seconddegree murder for the death of an unborn fetus
and of the attempted murder and assault of his
pregnant wife. The case against Green rested
entirely on the testimony of his wife, who had
been attacked, raped and beaten into unconsciousness while alone in their apartment. Green
maintained that he had left their home to get fast
food and that she was attacked in the brief time
he was gone. His wife maintained that he was
her attacker and claimed that he beat her after
she refused to have sex with him. After the creation of CODIS, the California Department of Justice laboratory found that the DNA profile from
sperm collected from the wife’s rape kit matched
Gerald Parker, a serial killer known as the “Bedroom Basher” for breaking into women’s bedrooms to rape and kill them. Parker confessed to
the attack on Green’s wife and was connected to
five other rapes and murders in the area.58

DNA

INITIATIVE

PRoACTivE UsEs of DNA

Confessions and guilty pleas
In approximately 25 percent of DNA exoneration
cases, innocent defendants pled guilty or made
incriminating statements or confessions.
Case example: Chris Ochoa. In 1988, Chris
Ochoa was an employee of the Pizza Hut restaurant chain in Austin, Texas. After a young woman
was found raped and murdered in another Pizza
Hut restaurant, Ochoa was brought in for questioning under the theory that a master key had
been used to gain access to the premises. After
several hours of interrogation, Ochoa gave a
detailed confession that contained important
details of the crime not available to the public. He
described in graphic detail how he and a friend
and fellow employee, Richard Danziger, raped
the victim before Ochoa shot her in the head.
Unlike many defendants who confess to crimes
while in police custody, Ochoa did not recant
his statements before the trial. Instead, he pled
guilty to the crime and went on to testify in detail
about the events of that night at Danziger’s trial.
Danziger was convicted on the basis of that
testimony, in addition to expert testimony that
a pubic hair found near the victim’s body was
microscopically similar to Danziger’s hair. However, in 1998, a man named Achim Marino wrote
to then-Governor George W. Bush, confessing
to the murder and stating that he could no longer
bear responsibility for the fact that two innocent
men were in prison for his crimes. Postconviction DNA testing subsequently showed that the
single male DNA profile obtained was a perfect
match to Marino, confirming Marino’s claim and
exonerating both Ochoa and Danziger by excluding them as the source of semen found in the
victim’s body.59

Possession of crime scene evidence
In several cases where DNA testing has brought
to light a wrongful conviction, the defendant’s
guilt seemed solidified by the fact that he possessed an item taken from the victim during the
crime.
Case example: Gene Bibbins. In 1986, police
in Louisiana arrested Gene Bibbins when they
found him with the radio that a man had stolen
from a teenage girl after raping her less than
an hour earlier. His clothing also resembled the

DNA

INITIATIVE

assailant’s outfit. Bibbins, who lived in the same
apartment complex as the victim, claimed he
found the radio between buildings. The radio,
along with the victim’s immediate identification
of Bibbins, led to his conviction. In addition, conventional serology testing could not exclude him
as a source of the semen from the victim’s rape
kit. However, in 2002, Bibbins was exonerated
after postconviction DNA testing excluded him
from the rape kit evidence.60
Case example: Robert Clark. In 2005, Robert
Clark was exonerated nearly 24 years after his
conviction for the rape of a woman in her car in
Georgia. Days after the crime, the victim saw a
man driving her car, which had been stolen during the attack. This man was Clark, who maintained that he received the car from a friend.
Nonetheless, the victim identified Clark as her
attacker, testifying that there was no doubt in
her mind. More than two decades later, postconviction DNA testing on a vaginal slide excluded
Clark. A CODIS hit matched the man whom Clark
had named as the source of the car, who by then
was in prison for subsequent crimes (but was on
the verge of release).61

Constitutional right to DNA testing
In states that do not have specific postconviction
DNA testing statutes, access to DNA evidence
may be obtained through the general postconviction statute dealing with newly discovered
evidence. However, many of the traditional postconviction statutes have time limits or other bars
to applications for DNA testing.
The issue of whether the U.S. Constitution provides a sentenced prisoner a right to DNA testing independent of state statute was largely but
not entirely resolved in DA’s Office for the Third
Judicial Dist. v. Osborne.62 Although federal law
and the laws of 46 states provide for at least
some access to DNA testing, Alaska did not. In
Osborne, the U.S. Supreme Court declined to
hold that an Alaskan inmate had a constitutional
right to testing enforceable under civil rights
laws as a due process claim. The Supreme Court
majority concluded that Alaska law provided
sufficient procedures for presenting “new”
evidence to satisfy due process concerns —
procedures the inmate had not invoked, the
majority contended.

­
161

CHAPTER 10

Osborne is a case of limited applicability. The
Supreme Court majority’s conclusion that Alaska
state law provided an avenue for the inmate
to seek testing did not answer the question of
when a state statute might be unreasonably
narrow or strict in its conditions, so that the
denial of access to evidence for DNA testing
might violate federal constitutional rights. What
is clear from Osborne is that any incarcerated
person who wants testing must first attempt to
use state law procedures before seeking relief
in federal court under a claim of a denial of due
process rights.

Useful resources
More than 40 projects and organizations in the
United States that work on postconviction cases
are affiliated with the Innocence Network. Consider contacting one of them for assistance, referrals,
or resources at www.innocencenetwork.org.

Endnotes
1. National Institute of Justice, U.S. Department
of Justice, Using DNA to Solve Cold Cases:
Special Report (July 2002), NCJ 194197.
2. President’s DNA Initiative, Advancing Justice
Through DNA Technology, www.dna.gov/uses/
solving-crimes/property_crimes/; Zedlewski, E.,
and M.B. Murphy, “DNA Analysis for ‘Minor’
Crimes: A Major Benefit for Law Enforcement,”
253 NIJ J our nal (January 2006), available at
www.ojp.usdoj.gov/nij/journals/253/dna_analysis.
html.
3. See State v. Peterson, 364 N.J. Super. 387,
397 (App. Div. 2003); New Jersey Death Penalty
Study Commission Report, Jan. 2007, at 52; Possley, M., “Convict Seeks New Trial on Basis of
Flawed Hair Analysis,” C hiCago T r ib une (July 29,
2005); Mansnerus, L., “Case Dropped Against
New Jersey Man After 18 Years,” n.Y. T im e s
(May 27, 2006).
4. See “Man Tells of Ordeal of 7 Years in
Prison,” D aYTon n e w s D ailY (Feb. 15, 2006); The
Innocence Project: Know the Cases — Clarence
Elkins, www.innocenceproject.org/Content/92.
php.

162

5. Bragg, R., “DNA Clears Louisiana Man on
Death Row, Lawyer Says,” n.Y. T im e s (April 22,
2003).
6. Glod, M., “Cleared Va. Man to Be Pardoned,”
T he w as hingTon P os T (Aug. 21, 2002).
7. Donald, M., “Lethal Rejection,” D allas
o b s e r ve r (Dec. 12, 2002).
8. People v. Wise, 752 N.Y.S.2d 837 (N.Y. Sup.
Ct. 2002).
9. Ga. Code Ann., § 24-4-63(b)(3) states, in
pertinent part:
Upon a showing by the defendant in a criminal case that access to the DNA data bank
is material to the investigation, preparation,
or presentation of a defense at trial or in a
motion for a new trial, a superior court having proper jurisdiction over such criminal
case shall direct the bureau to compare
a DNA profile which has been generated
by the defendant through an independent
test against the data bank, provided that
such DNA profile has been generated in
accordance with standards for forensic DNA
analysis adopted pursuant to 42 U.S.C. Section 14131, as amended.
10. 725 ILCS 5/116-5 (2003) states, in pertinent
part:
(a) Upon motion by a defendant charged
with any offense where DNA evidence may
be material to the defense investigation or
relevant at trial, a court may order a DNA
database search by the Department of State
Police. Such analysis may include comparing: (1) the genetic profile from forensic
evidence that was secured in relation to
the trial against the genetic profile of the
defendant, (2) the genetic profile of items
of forensic evidence secured in relation to
trial to the genetic profile of other forensic
evidence secured in relation to trial, or ...
cured in relation to trial, or (3) the genetic
profiles referred to in subdivisions (1) and (2)
against: … (ii) genetic profiles, including but
not limited to, profiles from unsolved crimes
maintained in state or local DNA databases
by law enforcement agencies.

DNA

INITIATIVE

PRoACTivE UsEs of DNA

11. N.C.G.S.A. § 15A-267 (2001) states, in pertinent part:
(c) Upon a defendant’s motion made before
trial in accordance with G.S. 15A- 952, the
court may order the SBI to perform DNA
testing and DNA Database comparisons
of any biological material collected but not
DNA tested in connection with the case
in which the defendant is charged upon a
showing of all of the following: (1) That the
biological material is relevant to the investigation. (2) That the biological material was
not previously DNA tested. (3) That the testing is material to the defendant’s defense.
12. 387 N.J. Super. 506, 521-22 (N.J. App. Div.
2006).
13. Saltzman, J., and M. Daniel, “Man Freed in
1997 Shooting of Officer,” b os Ton g lob e (Jan.
24, 2004).
14. 165 P.3d 31 (Wash. Ct. App. 2007).
15. National Institute of Justice, U.S. Department
of Justice, Postconviction DNA Testing: Recommendations for Handling Requests, Report From
the National Commission on the Future of DNA
Evidence, NCJ 177626 (September 1999), at 23.
16. For example, one test claims to be at least 10
times more sensitive than the presumptive acid
phosphatase test frequently used in laboratories.
See Denison, S.J., et al., “Positive ProstateSpecific Antigen (PSA) Results in Semen-Free
Samples,” 37 C an . s oC . F or e ns iC s Ci. J. 197, 200
(2004). In 16.8 percent (17 cases) of the forensic
casework samples tested in one recent study,
positive PSA levels were found in samples that
had previously tested negative for PSA and
where there were no visible spermatozoa (Id.).
17. See McFadden, R.D., “DNA Clears Rape
Convict After 12 Years,” n.Y. T im e s (May 20,
2003); “Wrong Man is Set Free by DNA,” n.Y.
P os T (May 20, 2003). Similarly, a New Jersey
court vacated the 1989 rape-murder conviction
of Larry Peterson after postconviction DNA testing showed that sperm on both vaginal and oral
swabs from the murder victim did not come
from Peterson but rather belonged to another
man (and also matched the DNA profile in the
victim’s fingernail scrapings). See Mansnerus,

DNA

INITIATIVE

L., “Citing DNA, Court Annuls Murder Conviction
from 1989,” n.Y. T im e s (July 30, 2005). These
same vaginal/oral swabs had been examined and
tested by the state’s forensic expert in 1989,
yet the state lab had failed to detect semen or
spermatozoa on any of these items. See Possley,
M., “Convict Seeks New Trial on Basis of Flawed
Hair Analysis,” C hiCago T r ib une ( July 29, 2005).
18. See “Finally Free, Ronald Taylor Has No
Grudges,” h ous Ton C hr oniCle (Oct. 10, 2007),
www.chron.com/disp/story.mpl/metropolitan/
falkenberg/5204596.html; The Innocence Project:
Know the Cases — Ronald Taylor, www.
innocenceproject.org/Content/1124.php.
19. See “Man Cleared in 1994 Rape Says Faith,
Perseverance Got Him Through Prison, Now
Free Thanks to DNA Evidence, Dean Cage Looks
to Start His Life Over,” C hiCago T r ib une (May 29,
2008); The Innocence Project: Know the Cases
— Dean Cage, www.innocenceproject.org/
Content/1376.php.
20. Santos, F., “DNA Testing Frees Man
Imprisoned for Half His Life,” n.Y. T im e s (Sept.
21, 2006).
21. Zeigler, M., and G. Craig, “Final Vindication,”
D e m oCr aT a nD C hr oniCle (March 7, 2007); Dobbin,
B., “DNA Tests Free Man Held 10 Years,” T he
b uFFalo n e w s (May 17, 2006).
22. Houck and Budowle, “Correlation of Microscopic and Mitochondrial DNA Hair Comparisons,” 47 J. F or e ns iC s Ci. 964, 966 (2002).
23. Id.
24. Jones, C.T., “DNA Tests Clear Two Men in
Prison,” D ailY o klahom an (April 16, 1999); Yardley, J., “The Innocent Man,” T he w as hingTon
P os T (Oct. 8, 2006).
25. National Institute of Justice, U.S. Department
of Justice, Postconviction DNA Testing: Recommendations for Handling Requests, at 14 (1999),
NCJ 177626, http://www.dna.gov/postconviction.
26. Id. at 27.
27. The NIJ guidelines provide the following
examples of Category 1 cases (that is, cases in
which exclusionary results would be dispositive

­
163

CHAPTER 10

of a petitioner’s innocence and “the prosecution
should be willing to stipulate to test testing”):
Example 2: Petitioner was convicted of the
rape of a woman who reported that she
was sexually attacked by two men. Vaginal
swabs were taken and preserved. Exoneration of the defendant may depend on
whether the DNA test of sperm on the vaginal swabs shows two male DNA profiles,
both of which exclude petitioner. (Id. at 4,
35)
28. Id. at 14.
29. “Wrongfully Held 20 Years, Md. Man to be
Freed Today, Imprisoned for Rape DNA Shows
He Did Not Commit,” T he b alTim or e s un (Nov. 7,
2002); “Md. DNA Evidence Yields New Suspect
in ’82 Rape; Earlier Test Freed Man After 20
Years,” T he w as hingTon P os T (Nov. 19, 2002).
30. Williams, T., “Freed by DNA, and Expressing
Compassion for Rape Victim,” n.Y. T im e s (July 7,
2006); Dwyer, J., “New York Fails at Finding Evidence to Help the Wrongfully Convicted,” n.Y.
T im e s (July 6, 2006).
31. See, e.g., Arey v. State, 929 A.2d 501, 507
(Md. 2007) (“[W]e carefully considered a cogent
report published by the National Commission of
the Future of DNA Evidence”); Blake v. State,
909 A.2d 1020, 1024-25 (Md. Ct. App. 2006).
32. National Institute of Justice, U.S. Department
of Justice, Postconviction DNA Testing: Recommendations for Handling Requests, at 45.
33. Id. at 7.
34. Id. (emphasis added).
35. Id. at 36 (emphasis added).
36. Harris, M., “DNA Search Delayed,” b alTim or e
s un (April 18, 2008).
37. Arey v. State, 929 A.2d 501, 508 (Md. 2007).
38. Blake v. State, 909 A.2d 1020, 1028, 1031
(Md. Ct. App. 2006).
39. People v. Pitts, 4 N.Y.3d 303, 311-312 (2005).

164

40. Id. at 508.
41. Id. at 508-09.
42. Id. at 508.
43. Id. at 508.
44. Id. at 508 (emphasis added).
45. Postconviction DNA Testing: Recommendations for Handling Requests (1999) states:
A prosecutor should normally agree to testing without opposition in category 1 cases.
For example, when a rape case turned solely, or in large part, on eyewitness testimony,
where serology at the time was inconclusive or not highly discriminating, and newer,
more discriminating tests are now available,
the prosecutor should order DNA testing.
(Id. at 40)
46. See 18 U.S.C. 3600; Ariz. Rev. Stat. §
13-4240; Ark. Code Ann. § 16-112-201; Cal. Penal
Code § 1405; Colo. Rev. Stat § 18-1-411); Conn.
Gen. Stat. Ann. § 52-582 (2003); Del. Code. tit.
11, § 4504; D.C. Code Ann. § 22- 4133; Fla.
Stat. Ann. § 925.11; Ga. Code Ann. § 5-5- 41(c);
Haw. Rev. Stat. §§ 844D 121-133; Idaho Code
§ 19-4902; 725 Ill. Comp. Stat. Ann. 5/116-3;
Ind. Code Ann. § 35-38-7; Iowa Code § 81.10;
Kan. Stat. Ann. § 21-2512; Kan. Stat. Ann. §
21-2512; Ky. Rev. Stat. § 422.285; Ky. Rev.
Stat. § 422.285; La. Code Crim. Proc. Ann. art.
926.1; Me. Rev. Stat. Ann. tit. 15, § 2137; Md.
Code Ann., Crim. Proc. § 8-201; Mich. Comp.
Laws § 770.16; Minn. Stat. § 590.01; Mo. Rev.
Stat. § 547.035; Mont. Code Ann. §§ 46-21-110,
53-1-214; Neb. Rev. Stat. § 29-4120; A.B. 16,
2003 Leg., 72nd Reg. Sess.; Nev. Rev. Stat. §
176.0918; N.H. Rev. Stat. Ann. § 651-D:1 - D:4;
N.J. Stat. Ann. § 2A:84A-32a; N.M. Stat. Ann.
§ 31-1a-2; N.Y. Crim. Proc. Law § 440.30(1-a);
N.C. Gen. Stat. § 15A-269; N.D. Cent. Code Ann.
§ 29-32.1-15; Ohio Rev. Code Ann. § 2953.71;
Or. Rev. Stat. § 138.510 et seq.; Pa. Stat. Ann.
42 § 9541 et seq.; S.C. Code Ann. §§ 17-28-10;
R.I. Gen. Laws § 10-9.1-11; Tenn. Code Ann.
§ 40-30-403; Tex. Code Crim. Proc. Ann. art.
64.01 et seq.; Utah Code Ann. § 78-35a-301; Vt.
Stat. Ann. tit. 13, § 5561 et seq.; Va. Code Ann.
§ 19.2-327.1; Wash. Rev. Code § 10.73.170;
W. Va. Code Ann. § 15 2B 14; Wi. Stat. Ann. §

DNA

INITIATIVE

PRoACTivE UsEs of DNA

974.07; Wyo. Stat. Ann. 7-12-302-315; Pa. Stat.
Ann. 42 § 9541 et seq.; S.C. Code Ann. §§ 17-2810; Vt. Stat. Ann. tit. 13, § 5561 et seq.; W. Va.
Code Ann. § 15 2B 14; Wyo. Stat. Ann. 7-12-302315- A.B. 16, 2003 Leg, 72nd Reg. Sess.
47. State v. Peterson, 364 N.J. Super. 387, 39596 (App. Div. 2003) (concluding “the strength
of the evidence against a defendant is not a relevant factor in determining whether his identity
as the perpetrator was a significant issue” and
finding identity was a significant issue under
N.J.S.A. 2A:84-32a(d)(3), where defendant’s only
defense was that he was not the perpetrator of
the crime).
48. People v. Urioste, 736 N.E.2d 706, 711-12
(Ill. App. Ct. 2000).
49. State v. Peterson, 364 N.J. Super. at 392.
50. Id. at 395.
51. Id. at 395-96.
52. See State v. Emerick, 868 N.E.2d 742, 746
(Ohio Ct. App. 2007) (ordering postconviction
DNA testing of evidence, including a hammer
and screwdriver used to murder the victims and
crime scene blood).
53. See State v. Peterson, 836 A.2d 821, 827
(N.J. 2003); State v. DeMarco, 387 N.J. Super.
506, 517 (2006) (“Even if a trial court concludes,
in light of the overwhelming evidence of a defendant’s guilt presented at trial, that it is unlikely
DNA testing will produce favorable results, the
court may not deny a motion for DNA testing
on that basis. Because it is difficult to anticipate what results DNA testing may produce in
advance of actual testing, the trial court should
postulate whatever realistically possible test
results would be most favorable to defendant
in determining whether he has established” the
statutory requirements for testing.), www.
innocenceproject.org.
54. Aside from the DNA exoneration cases, DNA
is yielding scores of pretrial exclusions. To illustrate, the Georgia Bureau of Investigation (GBI)
routinely performs DNA testing in homicide, rape
and other violent crime cases. Of the more than
700 cases in which GBI has conducted DNA
testing, 59 percent resulted in the inclusion of a

DNA

INITIATIVE

suspect and 25 percent excluded the suspect.
See www.state.ga.us/gbi/fsdna.html. DNA testing performed at the FBI laboratory, similarly,
has excluded 20 percent of the primary suspects and resulted in a match with the primary
suspect in only about 60 percent of the cases.
National Institute of Justice, U.S. Department of
Justice, Convicted by Juries, Exonerated by Science: Case Studies in the Use of DNA Evidence
to Establish Innocence After Trial, NCJ 161258
(June 1996), at xxviii.
55. O’Brien, K., “From Jail to Joy,” T he
T im e s -P iCaYune (March 12, 2005).
56. National Institute of Justice, U.S. Department of Justice, Convicted by Juries, Exonerated by Science: Case Studies in the Use of
DNA Evidence to Establish Innocence After Trial,
NCJ 161258 (June 1996), at 35-37; Valentine,
P.W., “Jailed for Murder, Freed by DNA: Md.
Waterman, Twice Convicted in Child’s Death, Is
Released,” T he w as hingTon P os T (June 29, 1993);
Hanes, S., “’84 Investigation Quick to Overlook
the Culprit,” b alTim or e s un (May 22, 2004);
Seigel, A.F., “Taking Felons’ DNA in Dispute,”
b alTim or e s un (June 7, 2004).
57. Associated Press, “Wrongly Convicted Man
Finally Sees Justice,” T he v ir ginia P iloT (Oct.
7, 1998); Goodyear, C., and E. Hallissy, “The
Other Side of DNA Evidence: An Innocent Man
is Freed,” T he s an F r anCis Co C hr oniCle (Oct. 19,
1999).
58. See Donald, M., “Lethal Rejection,” D allas
o b s e r ve r (Dec. 12, 2002); Wrolstad, M., “HairMatching Flawed as a Forensic Science; DNA
Testing Reveals Dozens of Wrongful Verdicts
Nationwide,” T he D allas m or ning n e w s (March
31, 2002).
59. See AP, “DNA Tests Free Convicted Rapist,”
(Dec. 6, 2002), available at www.cbsnews.com/
stories/2002/12/06/national/main532165.shtml.
See also Angelette, A., “Judge Officially Overturns Bibbins’ Rape Conviction,” T he a DvoCaTe
(March 12, 2003); Barrouquere, B., “Number of
Wrongful Convictions in LA Immense,” T he a Dvo CaTe (Nov. 23, 2003).
60. See AP, “DNA Tests Clear Georgia Inmate
of Rape Charges,” (Dec. 8, 2005). See also
Innocence Project, browse profiles under

­
165

CHAPTER 10

“Robert Clark,” at http://www.cbsnews.com/
stories/2002/12/06/national/main532165.html
(last visited July 20, 2007); see Innocence Project, browse profiles under “Donte Booker,” at
http://www.innocenceproject.org/Content/55.php
(last visited July 20, 2007) (Booker was convicted
of rape in Ohio on the basis of the victim’s identification, the fact he was found in possession of

166

an item that had been taken from the victim’s
car during the attack, and microscopy testimony.
He was exonerated through postconviction
DNA testing that excluded him from the rape
kit evidence.)
61. 129 S. Ct. 2308 (U.S. 2009).

DNA

INITIATIVE

Glossary

13 core CODIS loci: The 13 core CODIS autosomal loci are CSF1PO, D3S1358, D5S818,
D7S820, D8S1179, D13S317, D16S539, D18S51,
D21S11, FGA, THO1, TPOX and VWA.
Accreditation: Procedure used by an authoritative body that gives formal recognition to laboratories that have demonstrated (via production of
objective evidence) their competence to conduct
specified tasks.
Accredited DNA laboratory: A forensic DNA
laboratory that has received formal recognition
by an accrediting body that it meets or exceeds a
list of standards, including The Quality Assurance
Standards for Forensic DNA Testing Laboratories,
to perform certain tests.
Accrediting body: An organization that defines
the elements needed to demonstrate competence, administers its accreditation program, and
grants accreditation.
Acid phosphatase: A chemical substance found
in high quantities in semen/seminal fluid. The
AP test is a presumptive color test that is used
to screen for the presence of semen/seminal
fluid by detecting acid phosphatase content.
Also referred to as the seminal acid phosphatase
(SAP) test.
Acrosomal cap: A cap-like structure on the
tip (anterior end) of a sperm cell that contains
enzymes that aid in egg penetration during
fertilization.
Administrative review: An evaluation of a
report and the supporting documentation for
consistency with laboratory policies and editorial
correctness.

DNA

INITIATIVE

Allele calls: Allele calls for STRs are the designated numbers given to each allele detected for
a genetic marker. For amelogenin, allele calls
correspond to the designated letter(s) — X and
Y — that denote the detected DNA fragment or
fragments. Allele calls can be generated manually or via a software program.
Allele frequency: The proportion of a particular
allele in a population or population category (e.g.,
Caucasian, African-American, Hispanic or Asian).
Allele frequencies are calculated using the number of times an allele is observed in a sampling
of persons within a population. Allele frequencies
are then used to determine the probability that
a particular DNA profile might occur randomly in
the larger population from which the sampling
was obtained.
Alleles: Different forms of a gene or genetic
marker at a particular locus. An allele is described
as the characteristics of a single copy of a specific gene or of a single copy of a specific location on a chromosome. For example, one copy of
a specific short tandem repeat region might have
10 repeats, while the other copy might have 11
repeats. These would represent two alleles of
that short tandem repeat region, designated as
alleles 10 and 11, respectively.
Allelic drop-in: An allele not originating from the
sample but appearing on the electropherogram,
often caused by low-level contamination or use
of robotic systems for analysis.
Allelic drop-out: Failure to detect an allele within a sample, or failure to amplify an allele during a
polymerase chain reaction (PCR).

­167

Glossary

Amelogenin: Referred to as the gender differentiation locus, and colloquially as the sex determination locus. It is a gene present on the X and Y
sex chromosomes that is used in DNA identification testing to determine the gender of the DNA
donor in a biological sample.
Amplicon: A DNA sample that has undergone
the polymerase chain reaction (PCR) process.
Also referred to as amplified DNA.
Amplified DNA: A DNA sample that has undergone the polymerase chain reaction process
(PCR). Also referred to as an amplicon.
Analytical documentation: The documentation
of procedures, standards, controls and instruments used; observations made; results of tests
performed; and charts, graphs, photographs and
other documentation generated that are used to
support the analyst’s conclusions for a case.
Analytical procedure: A defined progression of
steps designed to ensure uniformity of a testing
process by all analysts within a laboratory on a
day-to-day basis and over time.
Analytical threshold: The minimum height
requirement at and above which detected peaks
can be reliably distinguished from background
noise on an electropherogram; peaks above this
threshold are generally not considered noise and
are either true alleles or artifacts.
Artifacts: Any non-allelic products of the amplification process (e.g., stutter or minus A/nontemplated nucleotide addition), anomalies of the
detection process (e.g., pull-up or spike), or byproducts of primer synthesis (e.g., a dye blob).
Aspermic male: A male who is unable to produce sperm. Colloquially, the terms aspermic
and azoospermic are often used interchangeably; however, technically, azoospermia refers
to a male who does not have sperm cells in his
ejaculate. The cause of aspermia may be sterility,
vasectomy, venereal disease or injury.
Assessment: An inspection used to evaluate,
confirm or verify activity related to quality. Also
called an audit.

­168

Audit: An inspection used to evaluate, confirm
or verify activity related to quality. Also called an
assessment.
Autoradiographic film: An X-ray film image
showing the position of radioactive substances.
Sometimes called an autorad.
Autosomal chromosomes: Chromosomes that
are not sex chromosomes.
Autosomal STR analysis/locations: DNA analysis that targets autosomal chromosomes for
short tandem repeat typing. Autosomal pertains
to chromosomes that are not sex chromosomes.
Individuals normally have 22 pair of autosomes
and one pair of sex chromosomes (X,X in
females or X,Y in males).
Azoospermic male: A male who does not have
sperm cells in his ejaculate. The cause may be
sterility (in this instance, the inability to produce
spermatozoa), vasectomy, disease or injury.
Bases/base pairs: Adenine (A), thymine (T),
cytosine (C) and guanine (G) are molecular building blocks of DNA, called bases. Each base will
only combine with its specific, corresponding
base to form base pairs when DNA is in its typical double-stranded form. This predictable pattern of base pairing — specifically, that A pairs
only with T (and vice versa) and C pairs only with
G (and vice versa) — is exploited during the DNA
typing process to make copies of very specific
areas on the DNA molecule (using a polymerase
chain reaction, or PCR) where differences
between people in the population are known to
exist.
Bayesian approach: System of probability based
on beliefs in which the measure of probability
is continuously revised as available information
changes.
Buccal sample/swab: A sample obtained from
the interior cheek area of the mouth.
Calculated match: A statistical calculation
performed on a match.

DNA

INITIATIVE

Glossary

Calibration: A set of operations that establish,
under specified conditions, the relationship
between values indicated by a measuring instrument or measuring system, or values represented by a material, and the corresponding known
values of a measurement. See Equipment
calibration.

in the cell nucleus, chromosomes consist of a
tightly coiled thread of DNA with associated proteins and RNA. The genes are arranged in linear
order along the DNA.

Capillary: A narrow silica tube containing a polymer solution used to separate out components
of a mixture based on their size and/or chemical
composition. See Capillary electrophoresis.

“Cold hit” DNA match: When the Combined
DNA Index System (CODIS) recognizes a match
between an offender’s DNA profile and a forensic DNA profile, it is referred to as a “cold hit.”

Capillary electrophoresis (CE): An instrument
used to separate fragments of DNA based on
size. The platform for CE uses narrow silica capillaries (or tubes) containing a polymer solution
through which the negatively charged DNA molecules migrate under the influence of a highvoltage electric field. An important advantage
of the multi-channel CE instruments, compared
with slab gel electrophoresis, includes easier
automation of analyses.

Combined DNA Index System (CODIS): CODIS
is a collection of databases of DNA profiles
administered by the FBI. CODIS contains DNA
profiles obtained from evidence samples from
solved and unsolved crimes, known individuals
convicted of particular crimes, missing persons
and relatives of missing persons, unidentified
human remains, and in some jurisdictions, individuals arrested for particular crimes. The three
levels of CODIS: the Local DNA Index System
(LDIS), used by individual laboratories; the State
DNA Index System (SDIS), the state’s DNA database containing profiles from the LDIS laboratories; and the National DNA Index System (NDIS),
managed at the national level by the FBI and
containing all of the DNA profiles that have been
uploaded from participating states.

Casework CODIS administrator: An employee
at a laboratory performing DNA analysis on
forensic and casework reference samples who
is responsible for administration and security of
the laboratory’s Combined DNA Index System
(CODIS).
Chain of custody: A continuous log documenting the location of sample(s) of physical evidence
collected from a crime scene at every step of the
process — from the crime scene to the laboratory to the analyst’s workstation, and any other
movement or handling in between (including any
time that evidence was removed from storage or
returned).
Christmas tree stain: A staining method used to
improve visualization of cells. In forensics, this
type of staining is used in microscopic examination for the presence of sperm cells and/or epithelial cells. Two solutions are used in the process:
Kernechtrot solution (also called nuclear fast red),
a red-staining solution; and Picro Indigo-Carmine
solution (also called picro-indigo-carmine), a greenstaining solution.
Chromosomes: The biological structure by
which hereditary information is physically transmitted from one generation to the next. Located

DNA

INITIATIVE

Coincidental match: A match that occurs by
chance.

Combined probability of exclusion (CPE): A
statistic produced by multiplying the probabilities
of inclusion from each location (locus) and subtracting the product from 1 (i.e., 1 – CPI). CPE is
also defined as the percentage of the population
that can be excluded from a mixed DNA profile.
Combined probability of inclusion (CPI): A statistic produced by multiplying the probabilities of
inclusion from each location (locus). Also defined
as the percentage of the population that can be
included in a mixed DNA profile.
Composite profile: A DNA profile generated
by combining DNA typing results from different
locations (loci) obtained from multiple injections
of the same amplified DNA sample and/or multiple amplifications of the same DNA extract.
When separate extracts from different locations
on a given evidentiary item are combined before
amplification, the resultant DNA profile is not
considered a composite profile.

169

Glossary

Confirmatory test: Testing used to confirm
the presence of a body fluid, such as blood or
semen.
Contamination: The unintentional introduction
of exogenous DNA into a DNA sample or into a
polymerase chain reaction (PCR).
Counting method: A statistical approach for
estimating the genotype frequency, and thus the
potential probative value, of a haplotype DNA
testing result generated as a result of mitochondrial DNA (mtDNA) testing or Y-STR DNA testing. This approach involves actually counting the
number of times the observed haplotype profile
has been observed in the population database(s)
being searched.
Critical equipment or instruments: Instruments or equipment requiring calibration or a
performance check before use and periodically
thereafter.
Critical reagents: Substances used for testing or
chemical reactions that have been determined,
by empirical studies or routine practice, to require
testing on established samples before use on
evidentiary or casework reference samples.
Cytoplasm: The viscid, semi-fluid matter contained within the plasma membrane of a cell,
excluding the nucleus.
Deconvolute/deconvolution: Separation of the
contributors to a mixed DNA profile into major
and/or minor contributor profiles. Deconvolution
is typically based on quantitative peak height
information and may depend on underlying
assumptions (e.g., whether the sample has been
deemed an intimate sample).
Degradation profile: A DNA typing profile in
which higher allele heights may be observed in
shorter fragments of DNA. A classic degradation pattern can be said to mimic a ski slope,
whereby the peak height diminishes as the DNA
fragments increase in length, from left to right on
the electropherogram.
Degraded DNA samples: Samples of DNA
that have been fragmented, or broken down, by
chemical or physical means.

­170

Deoxyribonucleic acid (DNA): Often referred
to as the “blueprint of life,” DNA is the genetic
material present in the nucleus of cells that is
inherited, half of which originates from each
biological parent. DNA is a chemical substance,
contained in cells, that determines a person’s
individual characteristics. An individual’s STR
DNA profile is unique, except in cases of identical twins.
Developmental validation: The acquisition of
test data, and the determination of conditions
and limitations of a new or novel DNA methodology, for use on forensic and/or casework reference samples.
Differential DNA amplification: The selection
of one target region or locus over another during
the polymerase chain reaction (PCR). Differential
amplification can also arise between two alleles
within a single locus if one of the alleles has a
mutation within a PCR primer binding site, causing the allele with the mutation to be copied less
efficiently because of the primer template
mismatch.
Differential DNA degradation: A DNA typing
result in which contributors to a DNA mixture are
subject to different levels of degradation (e.g.,
due to time of deposition), thereby impacting the
mixture ratios across the entire profile.
Differential DNA extraction: A procedure in
which sperm cells are separated, or extracted,
from all other cells in a sample.
Diploid: A cell (or organism) containing two complete sets of chromosomes. The pair of chromosomes is homologous.
Distinguishable DNA mixture: A DNA mixture
in which relative peak height ratios allow deconvolution of, or separation into, the profiles of
major and minor contributors.
DNA dragnet: Process of obtaining DNA
samples from multiple members of a specific
geographical area for comparison with evidence
samples to attempt to determine the identity
of the perpetrator of a crime. DNA dragnets are

DNA

INITIATIVE

Glossary

often conducted without any specific suspicion
of a particular individual’s guilt.
DNA extraction: Process where DNA is
removed, or isolated, from other present cellular
material in an evidence sample in order to conduct DNA type testing.
DNA marker: Refers to a specific chromosomal
location that is analyzed in a forensic DNA laboratory. The term DNA marker — rather than
“gene” — is typically used in forensics because
the areas of DNA (loci) being tested, with the
exception of amelogenin, do not code for a specific protein.
DNA match: The generation of the same alleles
at a locus or loci in an evidence sample and a reference sample. A DNA match will typically refer
to both the evidence/crime scene DNA profile
and the sample from a known individual having
the same DNA typing results at all loci for which
results were obtained.
DNA profile: The genetic makeup of an individual at defined locations (loci) in the DNA. A nuclear
DNA (nDNA) profile typically consists of one or
two alleles at a minimum of 13 STR loci plus the
amelogenin locus. A mitochondrial DNA (mtDNA)
profile is described in relation to the revised
Cambridge Reference Sequence.
DNA sample: An evidentiary sample or a sample
from a known source/reference submitted to a
laboratory for DNA testing.
DNA sequences: Specific combinations of four
bases of the DNA molecule: adenine (A), cytosine (C), guanine (G) and thymine (T).
Electropherogram: The graphic representation
of the separation of molecules by electrophoresis
or other means of separation.
Electrophoresis: A method of separating large
molecules (such as DNA fragments) from a mixture of similar molecules. An electric current is
passed through a medium at a different rate,
depending on its electrical charge and size.
Separation of DNA markers is based on these
differences.

DNA

INITIATIVE

Enzyme-linked immunosorbant assay (ELISA):
Common serological test for the presence of a
particular body fluid using corresponding antigens or antibodies. ELISA tests are rapid immunochemical analyses that involve the use of
antigens or antibodies and an enzyme (a protein
that catalyzes a biochemical reaction). ELISA
tests are typically highly sensitive and specific.
Epithelial cells: Cells from the outer surface of
the skin (epithelium) or a body cavity.
Equipment calibration: A test performed on
equipment or instruments that perform a particular operation or measurement to ensure accuracy
of results.
Evidentiary sample: For the purposes of DNA
testing, a biological sample recovered from a
crime scene or collected from persons or objects
associated with a crime.
Exclusion/exclusionary result: A conclusion
that eliminates an individual as a potential contributor of DNA obtained from an evidentiary
item, based on the comparison of known and
questioned DNA profiles (or multiple questioned
DNA profiles with each other). An exclusionary
DNA test result indicates that an individual is
excluded as the source of the DNA evidence. In
a criminal case, however, “exclusion” does not
necessarily equate to “innocence.” An exclusion
results when one or more loci from the DNA
profile of a known individual are not present in
the questioned DNA profile generated from an
evidence sample.
Exculpatory peaks/exculpatory values: A conclusion that excludes a suspect on the basis of
a DNA typing analysis, depending on the specific
threshold set by each laboratory; even a oneallele difference in a full, single-source DNA
profile can exclude a suspect as a possible
perpetrator.
Expectation bias: Having a strong belief or
mindset toward a particular outcome.
Forensic unknown: A DNA profile, obtained
from a crime scene evidence sample, that does
not match the DNA profile of a known individual.

171

Glossary

Four bases of a DNA molecule: Adenine (A),
cytosine (C), guanine (G) and thymine (T).
FST (Fst, Fst) value: A statistical value that measures the amount of variance in allele frequency
in a sampled population relative to the maximum
possible amount of variance in the population as
a whole. The FST value may also be considered
to be the proportion of the diversity in a sampled
population that is due to allele frequency differences among populations. More simply, the
FST is used to determine whether the variances
between two populations are significantly different. Typically, the lower the FST value, the better, and the more populations included (i.e., the
more global coverage), the more the FST value
stabilizes. However, there will always be population groups that are outliers.
Gamete: In humans, gametes are sperm cells
and egg cells. Gamete cells are haploid and combine during fertilization to form a new, diploid
organism.
Gene pool: A population of interbreeding individuals who share a common set of genes and
genetic markers; the system of Mendelian genetics is used for classification.
Genotype: The genetic constitution of an organism, as distinguished from its physical appearance (its phenotype). The designation of two
alleles at a particular locus is a genotype.
Haplogroup(s): A group of similar haplotypes
that share a common ancestor with a single
nucleotide polymorphism mutation.
Haplotype(s): The term for denoting the collective genotype of a number of closely linked loci
on a chromosome that are inherited together
or the sequence of the control regions of mitochondrial DNA that pass from a mother to her
offspring unchanged.
Haploid: A cell (or organism) containing only
one complete set of chromosomes. In humans,
sperm cells and egg cells are haploid.
Hardy-Weinberg equilibrium: In a large random
intrabreeding population not subjected to excessive selection or mutation, the gene and genotype frequencies will remain constant over time.

­172

The sum of p² + 2pq + q² applies at equilibrium
for a single allele pair, where p is the frequency
of the allele A, q is the frequency of a, p² is the
frequency of genotype AA, q² is the frequency of
aa, and 2pq is the frequency of Aa.
Heteroplasmic/heteroplasmy: The presence of
more than one mitochondrial DNA type within a
single individual.
Heterozygous/heterozygote: An individual having different alleles at a particular locus; usually
manifested as two distinct peaks for a locus in
an electropherogram. If two alleles are different
at one locus, the person is heterozygous at that
genetic location.
Homologous: Having similar characteristics and
structure. Diploid cells contain a set of homologous chromosomes.
Homozygous/homozygote: A homozygote is
an individual having the same (or indistinguishable) alleles at a particular locus, manifested as
a single peak for a locus in an electropherogram.
If two alleles at a locus are indistinguishable, the
person is homozygous at that genetic location.
Hypervariable: An area on the DNA that
can have many different alleles in differing
sequences.
Inclusion: A conclusion for which an individual
cannot be excluded as a potential contributor of
DNA obtained from an evidentiary item, based on
the comparison of known and questioned DNA
profiles (or multiple questioned DNA profiles
with each other). The inability to exclude an individual as a possible source of a biological sample
occurs when all the DNA typing at a specific
location in the DNA profile of a known individual
is the same typing as in the DNA profile from an
evidence sample.
Inconclusive or uninterpretable results: Interpretations or conclusions for which the DNA
typing results are insufficient, as defined by the
laboratory, for comparison purposes. A situation
in which no conclusion can be reached regarding testing performed can be due to a number
of situations, including no results obtained, uninterpretable results obtained, or no exemplar or
standard being available for testing.

DNA

INITIATIVE

Glossary

Indistinguishable DNA mixture: A DNA mixture in which relative peak height ratios are
insufficient to attribute alleles to individual
contributor(s).
Internal validation: Evaluation of the methods
of DNA analysis used in a specific laboratory to
ensure accurate measurements, equipment calibration, and adherence to standard protocols.
Intimate sample: Definitions of an intimate sample can vary, but the term most commonly refers
to a biological sample or swab recovered directly
from the interior or exterior of the body of an
individual, for example, from the vaginal, perianal
or buttocks area, or breast. An intimate sample is
generally expected to contain DNA from the person from whom the sample was collected.
Known sample: Biological material, for which
the donor’s identity is established, that is used
for comparison purposes.
Likelihood ratio (LR): The ratio of two probabilities of the same event under different hypotheses. In DNA testing, typically the numerator
contains the prosecutor’s hypothesis and the
denominator the defense’s hypothesis. This is
often expressed as the ratio between the likelihood that a given profile came from a particular
individual and the likelihood that it came from a
random unrelated person.
Linkage equilibrium: When two or more genetic loci appear to segregate randomly in a given
population. The genotypes for each locus appear
randomly with respect to each other.
Local DNA Index System (LDIS): The local
DNA index system of the Combined DNA Index
System (CODIS) is the entry point for casework
profiles being uploaded into the DNA databank.
Profiles that meet the criteria for entry into
LDIS can then be submitted to the State CODIS
Administrator for consideration.

the stochastic threshold values used for normal
interpretation. Also called low-level or low-quality
template DNA.
Major contributor(s): The individual(s) who
account for the major portion of DNA in a mixed
biological sample.
Masked allele: An allele of a minor contributor
that may not be readily distinguishable from the
alleles of the major contributor or an artifact.
Match: Genetic DNA profiles are said to
“match” when they have the same allele designations at every location on their corresponding
chromosomes.
Mini-STRs: Reduced-size amplicons for short
tandem repeat (STR) typing. They are created by
designing polymerase chain reaction (PCR) primers that bind closer to the targeted repeat unit.
This type of DNA typing is used when typing
degraded DNA samples.
Minor contributor(s): The individual(s) who
account for the lesser portion of DNA in a mixed
biological sample.
Mitochondria: Structures found outside the
nucleus of a cell whose function is to produce
energy. The DNA in mitochondria is genetically
distinct from the DNA in the nucleus of a cell.
Mitochondrion is the singular of mitochondria.
Mitochondrial DNA (mtDNA): The DNA found
in the many mitochondria in each cell of a human
body, except for red blood cells. The sequencing
of mtDNA can link individuals descended from a
common female ancestor.
Mixture: A DNA typing result originating from
two or more individuals.

Locus (pl. loci): The specific physical location(s)
of gene(s) on a chromosome.

Mixture ratio: The relative ratio of the DNA contributions of multiple individuals to a mixed DNA
typing result, using quantitative peak height
information. A mixture ratio may also be
expressed as a percentage.

Low copy number (LCN) DNA testing: Typically refers to either the examination of less than
100 picograms (0.1 nanogram) of input/template/
sample DNA, or the analysis of any results below

Modified random match probability (MRMP)
statistic: Not typically used for mixed DNA
samples, even when major contributor(s) can be
isolated and tested separately; other contributing

DNA

INITIATIVE

173

Glossary

DNA profiles in the sample may not be obtainable using this method.
Molecular Xeroxing: Refers to polymerase
chain reaction, an enzymatic process in which
specific regions of the DNA strand are replicated
over and over again.
National DNA Index System (NDIS): Commonly referred to as the national DNA databank.
Authorized by the DNA Identification Act of 1994,
NDIS is administered by the FBI. NDIS compares
evidence DNA profiles with DNA profiles collected from known convicted offenders and, in
some states, with arrestees as well as with other
evidence profiles that have been deemed acceptable for upload to NDIS. When DNA profiles are
uploaded to NDIS, they are searched against all
casework, convicted offender and arrestee sample profiles submitted by all participating states.
No results obtained: No allelic peaks are detected above the analytical threshold values previously established by the testing laboratory.
Noise: Background signal detected by a capillary
electrophoresis or other data collection instrument.
Nuclear DNA (nDNA): The DNA found in the
nucleus of a cell. Nuclear DNA testing includes
both autosomal STR DNA typing and Y-STR DNA
typing.
Nucleated cells: Cells having a nucleus.
Nucleus (pl. nuclei): The structure in a cell that
contains most of the DNA.
Oligozoospermic male/oligospermic male: A
male who produces less than 20 million spermatozoa per milliliter of ejaculate. Oligospermia has
many possible causes, and the effects of these
causes may be temporary or permanent.
p30: A protein, also called prostate-specific antigen (PSA), found in high quantities in semen/
seminal fluid that is male specific. In forensics,
detection of p30/PSA can be used to confirm the
presence of semen/seminal fluid. Produced by
cells of the prostate gland, p30, when at elevated
levels, can indicate potential prostate cancer.

all tested loci, typically due to DNA degradation,
inhibition of amplification and/or low-quantity
template DNA.
Peak height/peak height ratio (PHR): The
relative ratio of two alleles at a given locus, as
determined by dividing the peak height of an
allele with a lower relative fluorescent unit (RFU)
value by the peak height of an allele with a higher
RFU value, and then multiplying the value by 100
to express the PHR as a percentage; used to
indicate which alleles may be heterozygous pairs
and also in mixture deconvolution.
Phylogeographic/phylogeography: The study
of historical processes that are believed to be
responsible for the contemporary geographic distributions of individuals.
Polymarker/DQ alpha (PM/DQα): Early polymerase chain reaction (PCR) testing procedure,
often referred to as dot blot testing. PM/DQα
DNA markers are used to discriminate between
individuals, but they are less discriminating than
autosomal STR typing.
Polymerase chain reaction (PCR): A process
used in DNA testing in which one or more specific small regions of the DNA are copied, using
a DNA polymerase enzyme so that a sufficient
amount of DNA is generated for analysis.
Polymorphic/polymorphism: Having multiple
alleles that match at a specific gene within a
population.
Population genetics: The study of the distribution of genes in populations and how the frequencies of genes and genotypes are maintained
or changed.
Presumptive tests: A screening test used to
indicate the possible presence of the named
body fluid.
Primer binding site: Site at which the primer
binds to the DNA strand.
Primers: Short DNA sequences which precede
the region to be copied that are added to the
polymerase chain reaction.

Partial (incomplete) DNA profile: A DNA profile for which typing results are not obtained at

­174

DNA

INITIATIVE

Glossary

Proficiency: The demonstration of technical
skills and knowledge necessary to perform forensic DNA analysis successfully.

Rapid Stain Identification of Human Blood
(RSI-Blood): Test used to detect the presence
of human blood.

Proficiency test(s): Written, oral and/or practical
test, or series of tests, designed to establish that
an individual has demonstrated achievement of
technical skills and met minimum standards of
knowledge necessary to perform forensic DNA
analysis.

Raw data: Data generated from DNA testing
before analysis and interpretation.

Prostate-specific antigen (PSA): A protein, also
called p30, found in high quantities in semen/
seminal fluid that is male specific. In forensics,
detection of PSA/p30 can be used to confirm
the presence of semen/seminal fluid. PSA/p30 is
produced by cells of the prostate gland; elevated
levels in the blood indicate potential prostate
cancer.

Real allele peaks versus stutter: Peak on an
electropherogram that is representative of a true
DNA allele versus a peak or spike that is an artifact or anomaly that, although it may appear as
a true peak, it does not, in fact, represent actual
DNA.

qPCR data: Quantitative data of a polymerase
chain reaction (PCR), also called real-time PCR.
Quality assurance: The overall program used
to ensure the accuracy and reliability of the testing performed and the results reported by a
laboratory.
Quality assurance review (QAR): A program
conducted by a laboratory to ensure accuracy
and reliability of the tests performed.
Quality control: Each process or step used by
the laboratory to ensure the accuracy and reliability of the testing performed and the results
reported by a laboratory. Collectively, the quality
control steps, or measures, comprise the quality
assurance program
Quantitation slot blots: Method used to determine the quantity of “x” in a given sample. In
this context, it refers to the quantity of DNA in a
sample and is usually reported as nanograms per
microliter (ng/µl).
Questioned sample: A biological sample recovered from a crime scene or collected from persons or objects associated with a crime.
Random match/man probability (RMP): The
probability of randomly selecting an unrelated
individual from the population whose DNA is a
potential contributor to an evidentiary DNA
profile.

DNA

INITIATIVE

Reagents: Chemicals and test substances that
are added to a system to bring about a reaction
or to see whether a reaction occurs.

Reference sample: Biological material for which
the identity of the donor is established and used
for comparison purposes.
Relative fluorescence unit (RFU): A unit of
measurement used in electrophoresis methods
involving fluorescence detection. Fluorescence
is detected on the charge coupled device (CCD)
array as the labeled fragments, separated in the
capillary by electrophoresis and excited by the
laser, pass the detection window. The software
interprets the results, calculating the size and
relative quantity of the fragments from the fluorescence intensity at each data point.
Resolvable DNA mixture: Mixture of two or
more individuals’ DNA detected from an item
of evidence in which the ratios, and therefore
potentially the alleles, of major and minor contributors can be deduced due to the proportion of
one versus the other.
Restriction fragment length polymorphism
(RFLP): Variation in the length of a stretch of
DNA.
Revised Cambridge reference sequence
(rCRS): The rCRS is a modified version of the
original Cambridge Reference Sequence (a “master template” of the HVR-1 region of mitochondrial DNA); (GenBank #J01415.o gi:337188), from
Anderson, S., A.T. Bankier, B.G. Barrell, et al.,
“Sequence and Organization of the Human Mitochondrial Genome,” 290 N atur e 457–465 (1981).

175

Glossary

RNA: The abbreviation for ribonucleic acid, a
nucleic acid molecule similar to DNA. RNA contains ribose sugar within the structure, rather
than the deoxyribose in DNA.
Scientific Working Group on DNA Analysis
Methods (SWGDAM): A group of approximately
50 scientists representing federal, state and local
forensic DNA laboratories in the United States
and Canada. SWGDAM generates and promulgates interpretation guidelines for use by forensic DNA testing laboratories.
Semenogelin: A protein found in high quantities
in human semen, produced by seminal vesicles.
Seminal acid phosphatase (SAP): A chemical
substance found in high quantities in semen/
seminal fluid. The SAP test is a presumptive
color test that is used to screen for the presence of semen/seminal fluid by detecting acid
phosphatase content. Also referred to as the acid
phosphatase (AP) test.
Serology: In forensics, serology typically refers
to the initial examination of items of evidence
for the presence of blood, semen and/or other
biological materials and/or the recovery of portions of samples for DNA testing. In the general
scientific community, serology refers to the
study of serums, particularly the properties and
immunological (antigen-antibody) reactions of
blood serum.
Short tandem repeat (STR) DNA analysis/
typing: A method of DNA analysis that targets
regions on the chromosome that contain multiple
copies of a short DNA sequence in succession.
Signal-to-noise ratio: An assessment used to
establish an analytical threshold to distinguish
allelic peaks (signals) from background/instrument noise.
Single nucleotide polymorphisms (SNPs):
DNA sequence variations that occur at a single
nucleotide (A, T, C or G).
Single-source DNA sample/profile: A DNA profile in which only one individual has contributed
biologic material.

­176

Source attribution: A declaration that identifies
an individual as the source of an evidentiary profile to a reasonable degree of scientific certainty,
based on a single-source or major contributor
DNA profile.
Spermatozoa: Sperm cells; a male reproductive
cell.
Spermatozoon: A single sperm cell.
State DNA Index System (SDIS): Contains
qualifying casework and suspect DNA profiles/
records uploaded from local laboratory sites
within the state as well as the convicted offender
and arrestee samples for the state. SDIS is the
state’s repository of DNA identification records,
under the control of state authorities. Convicted
offender and arrestee profiles are entered into
CODIS at the SDIS level. The SDIS laboratory
serves as the central point of contact for access
to the National DNA Index System. The DNA
Analysis Unit serves as the SDIS laboratory for
the FBI.
Stochastic effects: The observation of peak
imbalance and/or allelic drop-out within a given
locus resulting from random, disproportionate
amplification of alleles in low-quantity template,
also called low level DNA, samples.
Stochastic threshold: The peak height value
above which it is reasonable to assume that, at a
given locus, allelic drop-out of a sister allele has
not occurred.
STR DNA analysis: See Short tandem repeat
(STR) analysis.
Stutter: A minor peak typically observed one
repeat unit smaller than a primary STR allele
resulting from strand slippage during amplification.
SWGDAM: See Scientific Working Group on
DNA Analysis Methods.
The product rule: The product rule calculates
the expected chance of finding a given short
tandem repeat (STR) profile within a population
by multiplying the frequency of occurrence of
the combination of alleles (genotype) found at a

DNA

INITIATIVE

Glossary

single locus, by the frequency of occurrence of
the genotype found at the second locus, and by
the frequency of occurrence, in turn, of each of
the other genotypes at the remaining STR loci.
Theta (ϴ) correction: A theta adjustment is a
mathematical correction applied to a frequency
calculation when both alleles at a locus are the
same (known as a homozygous state). It is not
applied when alleles are different at a locus
(known as a heterozygous state). This correction
adjusts the frequency slightly upward to account
for the presence of subpopulations in a general
population database that might otherwise cause
the genotype frequency to be underestimated at
that locus.
Touch DNA: DNA that is left behind, typically
from skin (epithelial) cells, when a person touches or otherwise comes into contact with an item
or person.

DNA

INITIATIVE

True match probability: A formula for determining the uniqueness of a DNA profile in a large
population, assuming that it is more or less
10-fold, based on guidelines established by the
National Research Council (NRC II, 1996) in The
Evaluation of Forensic DNA Evidence (National
Academies of Science). A confidence interval of
95-99 percent means that an individual is expected to have a unique DNA profile in a population
of 300 million, i.e., a true match probability of
30 billion to 1. This probability is then compared
with the random match probability (RMP) of the
evidence sample matching the reference sample.
Validation/validation studies of DNA analyses: The process of extensive and rigorous evaluation of DNA methods before acceptance for
routine use.
Y-STR DNA analysis/profile/typing: DNA typing in which short tandem repeats (STR) are
analyzed on the Y, or male, chromosome. This
is one variant on the pair of chromosomes (also
called sex chromosomes) in a DNA sequence
that define the sex of an individual.

177

About the National Institute of Justice
The National Institute of Justice — the research, development and
evaluation agency of the Department of Justice — is dedicated
to improving our knowledge and understanding of crime and justice
issues through science. NIJ provides objective and independent
knowledge and tools to reduce crime and promote justice,
particularly at the state and local levels.
NIJ’s pursuit of this mission is guided by the following principles:

Our principal authorities are
derived from:
•	� The Omnibus Crime Control and

Safe Streets Act of 1968, amended
(see 42 USC §§ 3721-3723)
•	� Title II of the Homeland Security Act

of 2002
•

Justice For All Act, 2004

•	� Research can make a difference in individual lives, in the
safety of communities and in creating a more effective
and fair justice system.
•	� Government-funded research must adhere to processes of
fair and open competition guided by rigorous peer review.

To find out more about the National
Institute of Justice, please visit:

•	� NIJ’s research agenda must respond to the real world needs
of victims, communities and criminal justice professionals.

www.nij.gov

•	� NIJ must encourage and support innovative and rigorous
research methods that can provide answers to basic research
questions as well as practical, applied solutions to crime.

National Criminal Justice
Reference Service
P.O. Box 6000
Rockville, MD 20849-6000
800-851-3420
www.ncjrs.gov

•	� Partnerships with other agencies and organizations, public
and private, are essential to NIJ’s success.

The National Institute of Justice is a component of the Office of Justice
Programs, which also includes the Bureau of Assistance; the Bureau of
Justice Statistics; the Office for Victims of Crime; the Office of Juvenile
Justice and Delinquency Prevention; and the Office of Sex Offender
Sentencing, Monitoring, Apprehending, Registering, and Tracking.

or contact:

U.S. Department of Justice
Office of Justice Programs
Washington, DC 20531
�
Official Business
Penalty for Private Use $300

*NCJ~237975*

MEDIA MAIL
POSTAGE & FEES PAID
�
DOJ/NIJ
�
PERMIT NO. G–91
�

 

 

The Habeas Citebook Ineffective Counsel Side
Advertise Here 4th Ad
CLN Subscribe Now Ad 450x600